Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EMU014681

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ezh2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTGTTCAGAGGGAGCAAAGCTTGCATTCATTTCATACGCTCTTCTGTCGACGATGTTTTAAGTATGACTGCTTCCTACATCCCTTCCATGCAACACCCAACACATATAAGAGGAAGAACACAGAAACAGCTTTGGACAACAAGCCTTGTGGACCACAGTGTTACCAGCATCTGGAGGGAGCTAAGGAGTTTGCTGCTGCTCTTACTGCTGAGCGTATAAAGACACCACCTAAACGCCCAGGGGGGCGCAGAAGAGGAAGACTTCCGAATAACAGTAGCAGACCCAGCACCCCCACCATCAGTGTGCTGGAGTCAAAGGATACAGACAGTGACAGAGAAGCAGGGACTGAAACTGGGGGAGAGAACAATGATAAAGAAGAAGAAGAGAAAAAAGATGAGACGTCCAGCTCCTCTGAAGCAAATTCTCGG

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

B C Roy et al.
Oncogene, 34(34), 4519-4530 (2014-12-09)
The enhancer of zeste homolog-2 (EZH2) represses gene transcription through histone H3 lysine-27-trimethylation (H3K27me3). Citrobacter rodentium (CR) promotes crypt hyperplasia and tumorigenesis by aberrantly regulating Wnt/β-catenin signaling. We aimed at investigating EZH2's role in epigenetically regulating Wnt/β-catenin signaling following bacterial
Ying Qi et al.
Molecular bioSystems, 11(7), 1980-1986 (2015-05-08)
A histone methyltransferase enhancer of zeste homologue 2 (EZH2) catalyzes trimethylation at histone H3 lysine27 (H3K27me3) and is frequently dysregulated in a wide range of human cancers. EZH2-mediated gene silencing contributes to carcinogenesis and regulates stem cell maintenance and differentiation;
Lu Lu et al.
Toxicology and applied pharmacology, 289(2), 276-285 (2015-09-30)
Lung cancer is regarded as the leading cause of cancer-related deaths, and cigarette smoking is one of the strongest risk factors for the development of lung cancer. However, the mechanisms for cigarette smoke-induced lung carcinogenesis remain unclear. The present study
Weisi Liu et al.
The Journal of biological chemistry, 290(47), 28489-28501 (2015-10-08)
Our previous studies identified the oncogenic role of p21-activated kinase 1 (PAK1) in hepatocellular carcinoma (HCC) and renal cell carcinoma (RCC). Contrarily, PAK6 was found to predict a favorable prognosis in RCC patients. Nevertheless, the ambiguous tumor suppressive function of
Jessica Svedlund et al.
Endocrine-related cancer, 21(2), 231-239 (2013-12-03)
Primary hyperparathyroidism (pHPT) resulting from parathyroid tumors is a common endocrine disorder with incompletely understood etiology. In renal failure, secondary hyperparathyroidism (sHPT) occurs with multiple tumor development as a result of calcium and vitamin D regulatory disturbance. The aim of

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique