Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EMU011661

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Icam1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGTACATACGTGTGCCATGCCTTTAGCTCCCATGGGAATGTCACCAGGAATGTGTACCTGACAGTACTGTACCACTCTCAAAATAACTGGACTATAATCATTCTGGTGCCAGTACTGCTGGTCATTGTGGGCCTCGTGATGGCAGCCTCTTATGTTTATAACCGCCAGAGAAAGATCAGGATATACAAGTTACAGAAGGCTCAGGAGGAGGCCATAAAACTCAAGGGACAAGCCCCACCTCCCTGAGCCTGCTGGATGAGACTCCTGCCTGGACCCCCTGCAGGGCAACAGCTGCTGCTGCTTTTGAACAGAATGGTAGACAGCATTTACCCTCAGCCACTTCCTCTGGCTGTCACAGAACAGGATGGTGGCCTGGGGGATGCACACTTGTAGCCTCAGAGCTAAGAGGACTCGGTGGATGG

Numéro d'accès Ensembl | souris

ENSMUSG00000037405

Numéro d'accès NCBI

NM_010493

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... ICAM1(15894) , Icam1(15894)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
QCS

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Weibao Xiao et al.
Experimental eye research, 138, 145-152 (2015-07-19)
FTY720 is a promising drug in attenuating multiple sclerosis, prolonging survival of organ allograft, and many other protective effects. Its mechanism of action is considered to be mediated by the internalization of sphingosine 1-phosphate receptors (S1PRs). In the current study
Chunhua Jin et al.
Molecular medicine (Cambridge, Mass.), 20, 280-289 (2014-06-12)
The myocardial inflammatory response contributes to cardiac functional injury associated with heart surgery obligating global ischemia/reperfusion (I/R). Toll-like receptors (TLRs) play an important role in the mechanism underlying myocardial I/R injury. The aim of this study was to examine the
Fumitake Ito et al.
The Journal of clinical endocrinology and metabolism, 99(6), 2188-2197 (2014-03-13)
Monocyte adhesion to endothelial cells is an important initial event in atherosclerosis and is partially mediated by adhesion molecule expression on the cell surface. Although estrogens inhibit atherosclerosis development, effects of coadministered progestogen remain controversial. We examined the effects of
Nicolas J Pillon et al.
American journal of physiology. Endocrinology and metabolism, 309(1), E35-E44 (2015-05-07)
Obesity is associated with inflammation and immune cell recruitment to adipose tissue, muscle and intima of atherosclerotic blood vessels. Obesity and hyperlipidemia are also associated with tissue insulin resistance and can compromise insulin delivery to muscle. The muscle/fat microvascular endothelium
Shiro Koizume et al.
Molecular cancer, 14, 77-77 (2015-04-17)
Elucidation of the molecular mechanisms by which cancer cells overcome hypoxia is potentially important for targeted therapy. Complexation of hypoxia-inducible factors (HIFs) with aryl hydrocarbon receptor nuclear translocators can enhance gene expression and initiate cellular responses to hypoxia. However, multiple
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique