Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EMU010191

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Gper

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCTACCTAGGTCCCGTGTGGCCAGCCCCTTCCAACAGCACCCCTCTGGCCCTCAACTTGTCCCTGGCACTGCGGGAAGATGCCCCGGGGAACCTCACTGGGGACCTCTCTGAGCATCAGCAGTACGTGATTGCCCTCTTCCTCTCCTGCCTCTACACCATCTTCCTCTTTCCTATTGGCTTTGTGGGCAACATCCTCATCCTGGTGGTGAACATCAGCTTCCGGGAGAAGATGACCATCCCAGACCTGTACTTCATCAACCTGGCGGCGGCCGACCTCATCCTGGTGGCTGACTCCCTGATTGAGGTGTTCAACCTGGACGAGCAGTACTACGACATCGCAGTGCTCTGCACCTTCATGTCCCTCTTCCTGCAGATCAACATGTACAGCAGCGTCTTCTTCCTCACCTGGATGAGCTT

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Rainer Girgert et al.
Breast cancer research and treatment, 134(1), 199-205 (2012-02-01)
Triple-negative breast cancers lack estrogen receptor α (ERα), progesterone receptor, and do not overexpress human epidermal growth factor receptor 2 (Her-2). They are neither susceptible to endocrine therapy nor to a therapy using the anti-Her-2 antibody, trastuzumab. Therefore, an efficient
Whitney K Petrie et al.
Obstetrics and gynecology international, 2013, 472720-472720 (2014-01-01)
Endometrial carcinoma is the most common cancer of the female reproductive tract. GPER/GPR30 is a 7-transmembrane spanning G protein-coupled receptor that has been identified as the third estrogen receptor, in addition to ERα and ERβ. High GPER expression is predictive
Nicolas Chevalier et al.
PloS one, 7(4), e34672-e34672 (2012-04-13)
Testicular germ cell tumours are the most frequent cancer of young men with an increasing incidence all over the world. Pathogenesis and reasons of this increase remain unknown but epidemiological and clinical data have suggested that fetal exposure to environmental
Q K Y Chan et al.
Cell death and differentiation, 17(9), 1511-1523 (2010-03-06)
G-protein-coupled receptor-30 (GPR30) shows estrogen-binding affinity and mediates non-genomic signaling of estrogen to regulate cell growth. We here showed for the first time, in contrast to the reported promoting action of GPR30 on the growth of breast and ovarian cancer
Wenqing Cao et al.
PloS one, 7(12), e52838-e52838 (2013-01-04)
Although evidence has shown the regulating effect of n-3 poly-unsaturated fatty acid (n-3 PUFA) on cell signaling transduction, it remains unknown whether n-3 PUFA treatment modulates estrogen signaling. The current study showed that docosahexaenoic acid (DHA, C22:6), eicosapentaenoic acid (EPA

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique