Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EMU010011

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tlr2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGACACTGGGGGTAACATCGCTTTTTCCCAATCTCACAAATTTACAAACCCTCAGGATAGGAAATGTAGAGACTTTCAGTGAGATAAGGAGAATAGATTTTGCTGGGCTGACTTCTCTCAATGAACTTGAAATTAAGGCATTAAGTCTCCGGAATTATCAGTCCCAAAGTCTAAAGTCGATCCGCGACATCCATCACCTGACTCTTCACTTAAGCGAGTCTGCTTTCCTGCTGGAGATTTTTGCAGATATTCTGAGTTCTGTGAGATATTTAGAACTAAGAGATACTAACTTGGCCAGGTTCCAGTTTTCACCACTGCCCGTAGATGAAGTCAGCTCACCGATGAAGAAGCTGGCATTCCGAGGCTCGGTTCTCACTGATGAAAGCTTTAACGAGCTCCTGAAGCTGTTGCGTTACA

Numéro d'accès Ensembl | souris

ENSMUSG00000027995

Numéro d'accès NCBI

NM_011905

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... TLR2(24088) , Tlr2(24088)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Seok-Seong Kang et al.
Cytokine, 75(1), 174-180 (2015-05-20)
Staphylococcus aureus can cause the intestinal inflammatory diseases. However, little is known about the molecular mechanism of S. aureus infection in the intestine. In the present study, we investigated whether S. aureus could stimulate human intestinal epithelial cells triggering inflammation.
Helge Haarmann et al.
Biochemical and biophysical research communications, 467(1), 46-52 (2015-09-30)
Bacterial colonisation with Moraxella catarrhalis may partly sustain chronic inflammation in the lower airways of patients with chronic obstructive pulmonary disease (COPD). In addition, this bacterium causes infectious exacerbations of COPD, which often necessitate treatment with antibiotics. Antimicrobial peptides are
Megumi Inomata et al.
PloS one, 13(8), e0202791-e0202791 (2018-08-29)
Porphyromonas gingivalis possesses various abilities to evade and disrupt host immune responses, by which it acts as an important periodontal pathogen. P. gingivalis produces outer membrane protein A (OmpA)-like proteins (OmpALPs), Pgm6 and Pgm7, as major O-linked glycoproteins, but their
Seung Heon Shin et al.
Allergy, asthma & immunology research, 8(1), 63-68 (2015-11-06)
Chronic rhinosinusitis with nasal polyps is a chronic inflammatory disease with markedly increased eosinophils, Th2-type lymphocytes, fibroblasts, and goblet cells. Fungi are commonly associated with airway inflammatory diseases, and thymic stromal lymphopoietin (TSLP) is important in the development of Th2
Min Li et al.
Biochemical and biophysical research communications, 466(4), 748-754 (2015-10-02)
Microphage apoptosis is a critical event in atherosclerotic lesions in patients with diabetes. In the present investigation, high glucose treatment inhibited Akt phosphorylation and activated caspase 3 in primary peritoneal macrophage, leading to cell apoptosis. Hypoxia prolonged macrophage survival in
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique