Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EMU009181

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ly6a

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCAGTCCTCCTGCAGACCTTGCTCTGATGGTCCTCCCAATGACCTCCACCCTTGTCCTTTTATCCTCATGTGCAACAATTCTTCCTGGAGCCCTCTAGTGATGAATTATGAGTTATAGAAGCTCCAAGGTGGGAGTAGTGTGTGAAATACCATGTTTTGCCTTTATAGCCCCTGCTGGGTAGGTAGGTGCTCTAATCCTCTCTAGGGCTTTCAAGTCTGTACTTCCTAGAATGTCATTTTGTTGTGGATTGCTGCTCATGACCCTGGAGGCACACAGCCAGCACAGTGAAGAGGCAGAATTCCAAGGTATTATGCTATCACCATCCACACATAAGTATCTGGGGTCCTGCAATGTTCCCACATGTATCCTGAATGTCCCCCTGTTGAGTCCAATAAACCCTTTGTTCTCCCAAAA

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xiaohua Jia et al.
BMC nephrology, 13, 105-105 (2012-09-12)
Bone marrow (BM) stem cells have been reported to contribute to tissue repair after kidney injury model. However, there is no direct evidence so far that BM cells can trans-differentiate into renal stem cells. To investigate whether BM stem cells
Yu-Chiao Hsu et al.
PloS one, 9(2), e88966-e88966 (2014-03-04)
Stem cell antigen-1 (Ly6a/Sca-1) is a gene that is expressed in activated lymphocytes, hematopoietic stem cells and stem cells of a variety of tissues in mice. Despite decades of study its functions remain poorly defined. These studies explored the impact
Hao Wang et al.
BMC biotechnology, 14, 75-75 (2014-08-12)
Myocardial infarction remains the leading cause of mortality in developed countries despite recent advances in its prevention and treatment. Regenerative therapies based on resident cardiac progenitor cells (CPCs) are a promising alternative to conventional treatments. However, CPCs resident in the

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique