Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EMU006911

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Lgals3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GATCACAATCATGGGCACAGTGAAACCCAACGCAAACAGGATTGTTCTAGATTTCAGGAGAGGGAATGATGTTGCCTTCCACTTTAACCCCCGCTTCAATGAGAACAACAGGAGAGTCATTGTGTGTAACACGAAGCAGGACAATAACTGGGGAAAGGAAGAAAGACAGTCAGCCTTCCCCTTTGAGAGTGGCAAACCATTCAAAATACAAGTCCTGGTTGAAGCTGACCACTTCAAGGTTGCGGTCAACGATGCTCACCTACTGCAGTACAACCATCGGATGAAGAACCTCCGGGAAATCAGCCAACTGGGGATCAGTGGTGACATAACCCTCACCAGCGCTAACCACGCCATGATCTAAGCCAGAAGGGGCGGCACCGAAACCGGCCCTGTGTGCCTTAGGAGTGGGAA

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Rafael Yamashita Ikemori et al.
PloS one, 9(11), e111592-e111592 (2014-11-05)
Galectin-3 (gal-3) is a β-galactoside binding protein related to many tumoral aspects, e.g. angiogenesis, cell growth and motility and resistance to cell death. Evidence has shown its upregulation upon hypoxia, a common feature in solid tumors such as glioblastoma multiformes
Lili Qiao et al.
Molecular medicine reports, 13(1), 160-166 (2016-01-01)
Galectin-3 is a multifunctional β-galactoside‑binding lectin that is involved in multiple biological functions which are upregulated in malignancies, including cell growth, adhesion, proliferation, progression and metastasis, as well as apoptosis. A previous study has confirmed the roles of galecin-3 overexpression
Junxiu Liu et al.
Gynecological endocrinology : the official journal of the International Society of Gynecological Endocrinology, 30(6), 461-465 (2014-03-22)
Vascular endothelial growth factor C (VEGF-C) promotes cervical cancer metastasis, while the detailed mechanism remains obscure. Recent evidence shows that galectin-3 (Gal-3), a glycan binding protein, interacts with the VEGF receptors and reinforces their signal transduction. In this study, we
D Zhu et al.
Leukemia, 29(7), 1587-1599 (2015-02-14)
The pathogenesis of Chlamydophila psittaci-negative ocular adnexal extranodal marginal zone lymphomas (OAEMZLs) is poorly understood. OAEMZLs are monoclonal tumors expressing a biased repertoire of mutated surface immunoglobulins. Antigenic activation of the B-cell receptor (BCR) may have a role in the
Sonja Aits et al.
Autophagy, 11(8), 1408-1424 (2015-06-27)
Lysosomal membrane permeabilization (LMP) contributes to tissue involution, degenerative diseases, and cancer therapy. Its investigation has, however, been hindered by the lack of sensitive methods. Here, we characterize and validate the detection of galectin puncta at leaky lysosomes as a

Global Trade Item Number

RéférenceGTIN
EMU006911-20UG4061828662197
EMU006911-50UG4061831376845

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique