Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU221111

Sigma-Aldrich

MISSION® esiRNA

targeting human AF165138.7

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AATTTAGAGAATGCAAAACCAAAAAAGAGAAAGTTATTCCGGAGATTTATGTCTGAAAATAAAATATTTGAAGGAAAAACTGTGAATGACAAAATCTGGCAGGAACACAGCAAGCATAAGAATGATTCCCACATCAGAAGGCCCTGTCAGCTAAAAGATCTAAATGAAAATGATTTTCTAAGTAACAACATACATACCTATCAAGGAAAAACTCTACAAGGAACTTCCTATCAGGTGACCTCTGAATGTTGGAGTCCATTTCACTATCAAAGACATGTTGAGACCACTG

Numéro d'accès Ensembl | humain

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Désolés, nous n'avons pas de COA pour ce produit disponible en ligne pour le moment.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Emma-Kate Loveday et al.
The Journal of general virology, 96(Pt 1), 30-39 (2014-09-23)
A common critical cellular event that many human enveloped viruses share is the requirement for proteolytic cleavage of the viral glycoprotein by furin in the host secretory pathway. For example, the furin-dependent proteolytic activation of highly pathogenic (HP) influenza A
Lin Wang et al.
Phytomedicine : international journal of phytotherapy and phytopharmacology, 22(12), 1079-1087 (2015-11-10)
Dihydrotanshinone I (DHTS) was previously reported to exhibit the most potent anti-cancer activity among several tanshinones in colon cancer cells. Its cytotoxic action was reactive oxygen species (ROS) dependent but p53 independent. To further study the anti-cancer activity of DHTS
T P H Nguyen et al.
Journal of molecular medicine (Berlin, Germany), 93(7), 795-805 (2015-02-27)
Fetal growth restriction (FGR) affects up to 5 % of pregnancies worldwide, and trophoblast function plays a significant role on the outcome. An epidemiological study has linked vitamin D deficiency to adverse perinatal outcomes, which include decreased birth weight. The

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique