Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU160281

Sigma-Aldrich

MISSION® esiRNA

targeting human KCNC4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCTGGTCTCCATCACCACTTTCTGCCTGGAGACCCATGAGGCCTTTAATATCGACCGCAACGTGACAGAGATCCTCCGCGTAGGGAACATCACCAGCGTGCACTTCCGGCGGGAGGTAGAGACAGAGCCCATCCTGACCTACATCGAGGGCGTATGTGTGCTGTGGTTCACACTGGAGTTCCTGGTGCGCATCGTGTGCTGCCCCGACACGCTGGACTTCGTCAAGAACCTGCTCAACATCATCGACTTTGTGGCCATCCTGCCCTTCTACCTGGAGGTGGGGCTGAGCGGCCTGTCATCCAAGGCGGCCCGCGACGTGCTGGGCTTCCTGCGCGTGGTGCGCTTCGTGCGCATCCTGCGTATCTTCAAGCTCACACGCCACTTCGTGGGGCTACGCGTGCTGGGCCACACCCTGAGGGCCAGCACCAATGAGTTCCTGCTGCTTATCATCTTCCTGGCCCTG

Numéro d'accès Ensembl | humain

ENSG00000116396

Numéro d'accès NCBI

NM_001039574

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... KCNC4(3749) , KCNC4(3749)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Min Seok Song et al.
International journal of molecular sciences, 19(4) (2018-04-05)
Voltage-gated potassium (Kv) channels, including Kv3.1 and Kv3.4, are known as oxygen sensors, and their function in hypoxia has been well investigated. However, the relationship between Kv channels and tumor hypoxia has yet to be investigated. This study demonstrates that
David M Ritter et al.
Channels (Austin, Tex.), 9(4), 209-217 (2015-06-04)
Recently, we reported the isolation of the Kv3.4 current in dorsal root ganglion (DRG) neurons and described dysregulation of this current in a spinal cord injury (SCI) model of chronic pain. These studies strongly suggest that rat Kv3.4 channels are

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique