Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU158181

Sigma-Aldrich

MISSION® esiRNA

targeting human SUV39H1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CGTGCTTACAGTGCTGGGTAGTGTTGGCCCTAAGAGCTGTAGGGTCTCTTCTTCAGGGCTGCATATCTGAGAAGTGGATGCCCACATGCCACTGGAAGGGAAGTGGGTGTCCATGGGCCACTGAGCAGTGAGAGGAAGGCAGTGCAGAGCTGGCCAGCCCTGGAGGTAGGCTGGGACCAAGCTCTGCCTTCACAGTGCAGTGAAGGTACCTAGGGCTCTTGGGAGCTCTGCGGTTGCTAGGGGCCCTGACCTGGGGTGTCATGACCGCTGACACCACTCAGAGCTGGAACCAAGATCTAGATAGTCCGTAGATAGCACTTAGGACAAGAATGTGCATTGATGGGGTGGTGATGAGGTGCCAGGCACTGGGTAGAGCACCTGGTCCACGTGGATTGTCTCAGGGAAGC

Numéro d'accès Ensembl | humain

ENSG00000101945

Numéro d'accès NCBI

NM_003173

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SUV39H1(6839) , SUV39H1(6839)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Kai Zhao et al.
Cell death & disease, 10(12), 877-877 (2019-11-23)
Runt-Related Transcription Factor 1 (RUNX1) is highly expressed in the Mesenchymal (Mes) subtype of glioblastoma (GBM). However, the specific molecular mechanism of RUNX1 in Mes GBM remains largely elusive. In this study, cell and tumor tissue typing were performed by
Xianliang Lai et al.
Cancer biomarkers : section A of Disease markers, 20(4), 453-460 (2017-09-28)
Epigenetic alteration plays critical roles in gliomagenesis by regulating gene expression through modifications of Histones and DNA. Trimethylation of H3K9, an essential repressed transcription mark, and one of its methyltransferase, SUV39H1, are implicated in glioma pathogenesis and progression. We find
Justin S Becker et al.
Molecular cell, 68(6), 1023-1037 (2017-12-23)
Heterochromatin is integral to cell identity maintenance by impeding the activation of genes for alternate cell fates. Heterochromatic regions are associated with histone 3 lysine 9 trimethylation (H3K9me3) or H3K27me3, but these modifications are also found in euchromatic regions that

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique