Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU156131

Sigma-Aldrich

MISSION® esiRNA

targeting human CASP4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGACAAAGTTCGGGTCATGGCAGACTCTATGCAAGAGAAGCAACGTATGGCAGGACAAATGCTTCTTCAAACCTTTTTTAACATAGACCAAATATCCCCCAATAAAAAAGCTCATCCGAATATGGAGGCTGGACCACCTGAGTCAGGAGAATCTACAGATGCCCTCAAGCTTTGTCCTCATGAAGAATTCCTGAGACTATGTAAAGAAAGAGCTGAAGAGATCTATCCAATAAAGGAGAGAAACAACCGCACACGCCTGGCTCTCATCATATGCAATACAGAGTTTGACCATCTGCCTCCGAGGAATGGAGCTGACTTTGACATCACAGGGATGAAGGAGCTACTTGAGGGTCTGGACTATAGTGTAGATGTAGAAGAGAATCTGACAGCCAGGGATATGGAGTCAGCGCTGAGGGCATTTGCTACCAGACCAGAGCACAAGTCCTCTGACAGCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Chanya Srisaowakarn et al.
Infection and immunity, 88(3) (2019-12-11)
Melioidosis is an infectious disease with a high mortality rate responsible for community-acquired sepsis in Southeast Asia and Northern Australia. The causative agent of this disease is Burkholderia pseudomallei, a Gram-negative bacterium that resides in soil and contaminated natural water.
Kwong Tai Cheng et al.
The Journal of clinical investigation, 127(11), 4124-4135 (2017-10-11)
Acute lung injury is a leading cause of death in bacterial sepsis due to the wholesale destruction of the lung endothelial barrier, which results in protein-rich lung edema, influx of proinflammatory leukocytes, and intractable hypoxemia. Pyroptosis is a form of
Nicolas J Pillon et al.
American journal of physiology. Endocrinology and metabolism, 311(5), E825-E835 (2016-11-03)
Obesity is associated with metabolic tissue infiltration by monocyte-derived macrophages. Saturated fatty acids contribute to proinflammatory gene induction in tissue-embedded immune cells. However, it is unknown how circulating monocytes, the macrophage precursors, react to high-fat environments. In macrophages, saturated fatty
Qiyun Zhong et al.
PLoS biology, 18(12), e3000986-e3000986 (2020-12-31)
Clustering of the enteropathogenic Escherichia coli (EPEC) type III secretion system (T3SS) effector translocated intimin receptor (Tir) by intimin leads to actin polymerisation and pyroptotic cell death in macrophages. The effect of Tir clustering on the viability of EPEC-infected intestinal
Jeanie Quach et al.
Mucosal immunology, 12(2), 323-339 (2018-10-27)
During invasion, Entamoeba histolytica (Eh) encounter macrophages and activate them to elicit tissue damaging pro-inflammatory responses. When Eh binds macrophages via the Gal-lectin, surface EhCP-A5 RGD sequence ligates α5β1 integrin to activate caspase-1 in a complex known as the NLRP3

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique