Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU155731

Sigma-Aldrich

MISSION® esiRNA

targeting human CCR7

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCCAGGTATGCCTGTGTCAAGATGAGGTCACGGACGATTACATCGGAGACAACACCACAGTGGACTACACTTTGTTCGAGTCTTTGTGCTCCAAGAAGGACGTGCGGAACTTTAAAGCCTGGTTCCTCCCTATCATGTACTCCATCATTTGTTTCGTGGGCCTACTGGGCAATGGGCTGGTCGTGTTGACCTATATCTATTTCAAGAGGCTCAAGACCATGACCGATACCTACCTGCTCAACCTGGCGGTGGCAGACATCCTCTTCCTCCTGACCCTTCCCTTCTGGGCCTACAGCGCGGCCAAGTCCTGGGTCTTCGGTGTCCACTTTTGCAAGCTCATCTTTGCCATCTACAAGATGAGCTTCTTCAGTGGCATGCTCCTACTTCTTTGCATCAGCATTGACC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Pelin Kaya et al.
Nutrients, 11(2) (2019-02-20)
Curcumae radix is the dry root of Curcuma longa L. (turmeric) that can be used either as a spice or traditional medicine. The aim of this study was to investigate the survival benefits and the anti-metastatic activity of curcumae radix
Bing Xu et al.
Cancer medicine, 6(5), 1062-1071 (2017-04-06)
Chemokine and the chemokine receptor have a key role in the tumor progress. Here, we supposed that CCR7 might induce the invasion, migration, and epithelial-mesenchymal transition (EMT) process of breast cancer. In this research, human breast cancer MCF-7 and MDA-MB-231cells
Lin-Hui Yuan et al.
International journal of ophthalmology, 10(6), 862-869 (2017-07-22)
To investigate the role of CCR7/p-ERK1/2/VEGF signaling in the mouse model of oxygen-induced retinopathy (OIR). Neonatal C57BL/6J mice were evenly randomized into four groups: normoxia, OIR, OIR control (treated with scramble siRNA), and OIR treated (treated with CCR7 siRNA). Normoxia
Fei Li et al.
Medical oncology (Northwood, London, England), 31(9), 180-180 (2014-08-22)
Secondary lymphoid tissue chemokine (SLC/CCL21) and its receptor CCR7 have been implicated in lymph node metastasis, whereas the mechanism of which remains unclear. Epithelial-mesenchymal transition (EMT) plays an important role in invasion and migration of cancer cells. We presumed that
Kaori Kubo et al.
Biochemical and biophysical research communications, 463(4), 825-831 (2015-06-24)
Chronic myeloid leukemia is a clonal disease characterized by the presence of the Philadelphia chromosome and its oncogenic product, BCR-ABL, which activates multiple pathways involved in cell survival, growth promotion, and disease progression. We previously reported that in murine hematopoietic

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique