Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU145621

Sigma-Aldrich

MISSION® esiRNA

targeting human CLDN7

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAAAGTGAAGAAGGCCCGTATAGCCATGGGTGGAGGCATAATTTTCATCGTGGCAGGTCTTGCCGCCTTGGTAGCTTGCTCCTGGTATGGCCATCAGATTGTCACAGACTTTTATAACCCTTTGATCCCTACCAACATTAAGTATGAGTTTGGCCCTGCCATCTTTATTGGCTGGGCAGGGTCTGCCCTAGTCATCCTGGGAGGTGCACTGCTCTCCTGTTCCTGTCCTGGGAATGAGAGCAAGGCTGGGTACCGTGTACCCCGCTCTTACCCTAAGTCCAACTCTTCCAAGGAGTATGTGTGACCTGGGATCTCCTTGCCCCAGCCTGACAGGCTATGGGAGTGTCTAGATGCCTGAAAGGGCCTGGGGCTGAGCTCAGCCTGTGGGCAGGGTGCCGGACAAAGGCCTCCTGGTCACTCT

Numéro d'accès Ensembl | humain

ENSG00000181885

Numéro d'accès NCBI

NM_001307

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CLDN7(1366) , CLDN7(1366)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Di Gao et al.
Theriogenology, 158, 346-357 (2020-10-11)
Trophectoderm (TE) barrier function is an essential prerequisite for blastocyst development. CLAUDIN7 (CLDN7), a member of CLAUDINS family, is involved in regulating intercellular exchange and cell polarity in epithelium cells. However, the role of CLDN7 in porcine early embryo development
Thanh Q Dang et al.
The Journal of endocrinology, 234(2), 101-114 (2017-07-15)
Altered permeability of the endothelial barrier in a variety of tissues has implications both in disease pathogenesis and treatment. Glucocorticoids are potent mediators of endothelial permeability, and this forms the basis for their heavily prescribed use as medications to treat
Norimitsu Okui et al.
Pancreatology : official journal of the International Association of Pancreatology (IAP) ... [et al.], 19(1), 88-96 (2018-11-13)
Pancreatic cancer consists of various subpopulations of cells, some of which have aggressive proliferative properties. The molecules responsible for the aggressive proliferation of pancreatic cancer may become molecular targets for the therapies against pancreatic cancer. From a human pancreatic cancer
Fabian Horné et al.
Reproductive sciences (Thousand Oaks, Calif.), 26(9), 1181-1192 (2018-12-06)
Claudins are the major components of tight junctions and are often deregulated in human cancer, permitting escape of cancer cells along with the acquisition of invasive properties. Similarly, endometrial cells also show invasive capabilities; however, the role of tight junctions

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique