Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU145491

Sigma-Aldrich

MISSION® esiRNA

targeting human MEF2D

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCCACTGCCTACAACACAGATTACCAGTTGACCAGTGCAGAGCTCTCCTCCTTACCAGCCTTTAGTTCACCTGGGGGGCTGTCGCTAGGCAATGTCACTGCCTGGCAACAGCCACAGCAGCCCCAGCAGCCGCAGCAGCCACAGCCTCCACAGCAGCAGCCACCGCAGCCACAGCAGCCACAGCCACAGCAGCCTCAGCAGCCGCAACAGCCACCTCAGCAACAGTCCCACCTGGTCCCTGTATCTCTCAGCAACCTCATCCCGGGCAGCCCCCTGCCCCACGTGGGTGCTGCCCTCACAGTCACCACCCACCCCCACATCAGCATCAAGTCAGAACCGGTGTCCCCAAGCCGTGAGCGCAGCCCTGCGCCTCCCCCTCCAGCTGTGTTCCCAGCTGCCCGCCCTGAGCCTGGCGATGGTCTCAGCAGCCCAGCCGGGGGATCCTATGAGACGGGAGACCGGGATGACGGACGGGGGGACTTCGGGCCCACACTGGGCCTGCTGCGCCCAGCCCCAGAGCCTGAGGCTGAGGGCTCAGCTGTGAAGAGGATGCGGCTTGATA

Numéro d'accès Ensembl | humain

ENSG00000116604

Numéro d'accès NCBI

NM_005920

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... MEF2D(4209) , MEF2D(4209)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Shuna Li et al.
Aging, 12(7), 6456-6466 (2020-04-10)
Cochlear ribbon synapses play a pivotal role in the prompt and precise acoustic signal transmission from inner hair cells (IHCs) to the spiral ganglion neurons, while noise and aging can damage ribbon synapses, resulting in sensorineural hearing loss. Recently, we
Zhi-Qin Hu et al.
Oncotarget, 8(54), 92079-92089 (2017-12-02)
The role of microRNA-92b-3p (miR-92b-3p) in cardiac hypertrophy was not well illustrated. The present study aimed to investigate the expression and potential target of miR-92b-3p in angiotensin II (Ang-II)-induced mouse cardiac hypertrophy. MiR-92b-3p was markedly decreased in the myocardium of
Haiyun Chen et al.
Aging, 12(14), 14897-14917 (2020-07-28)
T-006, a new derivative of tetramethylpyrazine, has been recently found to protect against 6-hydroxydopamine (6-OHDA)-induced neuronal damage and clear α-synuclein (α-syn) by enhancing proteasome activity in an α-syn transgenic Parkinson's disease (PD) model. The effect of T-006 on the 1-methyl-4-phenyl-1
Jung-Hwa Han et al.
Life sciences, 135, 1-8 (2015-06-03)
bFGF is a potent mitogen of cells associated with fibrosis. Although ERK5 has been reported to play roles in the development of fibrosis, its roles in regulating bFGF-induced fibrotic responses are not understood, especially in lung fibroblasts. The authors investigated
Yeyou Liang et al.
Metabolism: clinical and experimental, 64(12), 1682-1693 (2015-10-13)
Evidence shows that both macrophage migration inhibitory factor (MIF) and GLUT4 glucose transporter are involved in diabetic cardiomyopathy (DCM), but it remains largely unknown whether and how MIF regulates GLUT4 expression in cardiomyocytes. The present study aims to investigate the

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique