Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU144411

Sigma-Aldrich

MISSION® esiRNA

targeting human ARF1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCTTAAGCTGGGTGAGATCGTGACCACCATTCCCACCATAGGCTTCAACGTGGAAACCGTGGAGTACAAGAACATCAGCTTCACTGTGTGGGACGTGGGTGGCCAGGACAAGATCCGGCCCCTGTGGCGCCACTACTTCCAGAACACACAAGGCCTGATCTTCGTGGTGGACAGCAATGACAGAGAGCGTGTGAACGAGGCCCGTGAGGAGCTCATGAGGATGCTGGCCGAGGACGAGCTCCGGGATGCTGTCCTCCTGGTGTTCGCCAACAAGCAGGACCTCCCCAACGCCATGAATGCGGCCGAGATCACAGACAAGCTGGGGCTGCACTCACTACGCCACAGGAACTGGTACATTCAGGCCACCTGCGCCACCAGCGGCGACGGGCTCTATGAAGGACTGGACTGGCTGTCCAATCAGCTCCGGAACCAGAAGTGAACGCGACCCCCCTCCCTCTCACTCCTCTTGCCCTCTGCTTTA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Nisha Bte Mohd Rafiq et al.
The Journal of cell biology, 216(1), 181-197 (2016-12-23)
Podosomes represent a class of integrin-mediated cell-matrix adhesions formed by migrating and matrix-degrading cells. We demonstrate that in macrophage-like THP1 cells and fibroblasts stimulated to produce podosomes, down-regulation of the G-protein ARF1 or the ARF1 guanine nucleotide exchange factor, ARNO
Tatsuyuki Matsudaira et al.
Journal of cell science, 128(16), 3131-3142 (2015-07-03)
The retrograde pathway is defined by the transport of proteins and lipids from the plasma membrane through endosomes to the Golgi complex, and is essential for a variety of cellular activities. Recycling endosomes are important sorting stations for some retrograde
Christin Münzberg et al.
Journal of cellular and molecular medicine, 19(5), 948-959 (2015-03-11)
Hypersecretion is the major symptom of functional neuroendocrine tumours. The mechanisms that contribute to this excessive secretion of hormones are still elusive. A key event in secretion is the exit of secretory products from the Golgi apparatus. ADP-ribosylation factor (Arf)

Protocoles

Coronavirus qPCR Primer and probe sets for the detection of SARS-CoV-2 (Corona Virus), with additional real-time RT-PCR, RT-qPCR and supporting reagents available.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique