Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU141461

Sigma-Aldrich

MISSION® esiRNA

targeting human RELA

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCAATGGCTACACAGGACCAGGGACAGTGCGCATCTCCCTGGTCACCAAGGACCCTCCTCACCGGCCTCACCCCCACGAGCTTGTAGGAAAGGACTGCCGGGATGGCTTCTATGAGGCTGAGCTCTGCCCGGACCGCTGCATCCACAGTTTCCAGAACCTGGGAATCCAGTGTGTGAAGAAGCGGGACCTGGAGCAGGCTATCAGTCAGCGCATCCAGACCAACAACAACCCCTTCCAAGTTCCTATAGAAGAGCAGCGTGGGGACTACGACCTGAATGCTGTGCGGCTCTGCTTCCAGGTGACAGTGCGGGACCCATCAGGCAGGCCCCTCCGCCTGCCGCCTGTCCTTTCTCATCCCATCTTTGACAATCGTGCCCCCAACACTGCCGAGCTCAAGAT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xiu-Lei Zhang et al.
Biochimica et biophysica acta. General subjects, 1863(10), 1443-1457 (2019-05-20)
Lung cancer is the leading cause of global cancer deaths. Current chemotherapeutic agents for lung cancer treatment are generally accompanied with severe side effects. Here, we report that marchantin C (Mar-C), a potential natural compound with little chemotherapeutic toxicity, exerts
Zhi-Yuan Li et al.
Aging, 8(10), 2337-2354 (2016-10-08)
The corneal epithelium plays important roles in the maintenance of corneal transparency for good vision, and acts as a protective barrier against foreign insults. Structural and functional changes with aging in the corneal epithelium have been documented. Here we found
Masayuki Hiraki et al.
Signal transduction and targeted therapy, 3, 13-13 (2018-05-16)
B-cell lymphoma 2-related protein A1 (BCL2A1) is a member of the BCL-2 family of anti-apoptotic proteins that confers resistance to treatment with anti-cancer drugs; however, there are presently no agents that target BCL2A1. The MUC1-C oncoprotein is aberrantly expressed in
Ichiro Yajima et al.
Archives of toxicology, 91(11), 3507-3516 (2017-05-05)
Chronic exposure to arsenic is associated with various diseases in humans. Skin hyperpigmentation is the most sensitive objective symptom for patients with arsenicosis. However, there is very limited information about the mechanism of arsenic-mediated skin hyperpigmentation in vivo. In this
Qiang Liu et al.
Nephron, 139(4), 349-358 (2018-05-24)
Given the importance of neutrophil recruitment in the pathogenesis of glomerulonephritis (GN), the representative neutrophil chemoattractant C-X-C motif chemokine 1 (CXCL1)/GROα and the adhesion molecule E-selectin in glomerular endothelial cells (GECs) play a pivotal role in the development of GN.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique