Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU141171

Sigma-Aldrich

MISSION® esiRNA

targeting human ATPIF1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CGTGAGGACCATGCAAGCCCGAGGCTTCGGCTCGGATCAGTCCGAGAATGTCGACCGGGGCGCGGGCTCCATCCGGGAAGCCGGTGGGGCCTTCGGAAAGAGAGAGCAGGCTGAAGAGGAACGATATTTCCGACATTACAGGTTATGCTTTGAGATCTCTTTGGGGTGAAGGATTGAAATTAAACCCTGAGCCACCGTGTCCTTGTAGAGCACAGAGTAGAGAACAACTGGCAGCTTTGAAAAAACACCATGAAGAAGAAATCGTTCATCATAAGAAGGAGATTGAGCGTCTGCAGAAAGAAATTGAGCGCCATAAGCAGAAGATCAAAATGCTAAAACATGATGATTAAGTGCACACCGTGTGCCATAGAATGGCACATGTCATTGCCCACTTCTGTGT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Kévin Hardonnière et al.
Scientific reports, 7(1), 195-195 (2017-03-17)
Most tumors undergo metabolic reprogramming towards glycolysis, the so-called Warburg effect, to support growth and survival. Overexpression of IF1, the physiological inhibitor of the F0F1ATPase, has been related to this phenomenon and appears to be a relevant marker in cancer.
Yuyu Zhang et al.
Frontiers in immunology, 12, 590447-590447 (2021-03-16)
MicroRNAs (miRNAs) have been discovered to dictate the development of various tumors. However, studies on the roles of miRNAs in the progression of gastric cancer (GC) are still lacking. Herein, by analyzing GC cell lines and patients samples, we observed
Pamela Maher
Antioxidants (Basel, Switzerland), 10(1) (2021-01-21)
Although the hallmarks of Alzheimer's disease (AD) are amyloid beta plaques and neurofibrillary tangles, there is growing evidence that neuroinflammation, mitochondrial dysfunction and oxidative stress play important roles in disease development and progression. A major risk factor for the development
Yun Chen et al.
PloS one, 9(5), e98483-e98483 (2014-05-24)
Previous studies showed that prostacyclin inhibited fibrosis. However, both receptors of prostacyclin, prostacyclin receptor (IP) and peroxisome proliferator-activated receptor (PPAR), are abundant in cardiac fibroblasts. Here we investigated which receptor was vital in the anti-fibrosis effect of prostacyclin. In addition
Fabrice Ivanes et al.
British journal of pharmacology, 171(18), 4193-4206 (2014-03-20)
Ischaemia compromises mitochondrial respiration. Consequently, the mitochondrial F1 Fo-ATPsynthase reverses and acts as a proton-pumping ATPase, so maintaining the mitochondrial membrane potential (ΔΨm ), while accelerating ATP depletion and cell death. Here we have looked for a molecule that can

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique