Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU139921

Sigma-Aldrich

MISSION® esiRNA

targeting human KAT5

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTCACCCGGATGAAGAACATTGAGTGCATTGAGCTGGGCCGGCACCGCCTCAAGCCGTGGTACTTCTCCCCGTACCCACAGGAACTCACCACATTGCCTGTCCTCTACCTGTGCGAGTTCTGCCTCAAGTACGGCCGTAGTCTCAAGTGTCTTCAGCGTCATTTGACCAAGTGTGACCTACGACATCCTCCAGGCAATGAGATTTACCGCAAGGGCACCATCTCCTTCTTTGAGATTGATGGACGTAAGAACAAGAGTTATTCCCAGAACCTGTGTCTTTTGGCCAAGTGTTTCCTTGACCATAAGACACTGTACTATGACACAGACCCTTTCCTCTTCTACGTCATGACAGAGTATGACTGTAAGGGCTTCCACATCGTGGGCTACTTCTCCAAGGAGAAAGAATCAACGGAAGACTACAATGTGGCCTGCATCCTAAC

Numéro d'accès Ensembl | humain

ENSG00000172977

Numéro d'accès NCBI

NM_006388

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... KAT5(10524) , KAT5(10524)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jian Li et al.
PloS one, 6(8), e23725-e23725 (2011-08-23)
GPR50 is an orphan G-protein coupled receptor most closely related to the melatonin receptors. The physiological function of GPR50 remains unclear, although our previous studies implicate the receptor in energy homeostasis. Here, we reveal a role for GPR50 as a
Xueqin Wang et al.
BMC microbiology, 10, 228-228 (2010-08-28)
Salmonella enterica is a facultative intracellular pathogen that replicates within a membrane-bound compartment termed Salmonella containing vacuole (SCV). The biogenesis of SCV requires Salmonella type III protein secretion/translocation system and their effector proteins which are translocated into host cells to
Shengyuan Zeng et al.
Protein & cell, 8(3), 202-218 (2016-10-16)
UHRF2 is a ubiquitin-protein ligase E3 that regulates cell cycle, genomic stability and epigenetics. We conducted a co-immunoprecipitation assay and found that TIP60 and HDAC1 interact with UHRF2. We previously demonstrated that UHRF2 regulated H3K9ac and H3K14ac differentially in normal
Deepa Rajagopalan et al.
PLoS pathogens, 13(10), e1006681-e1006681 (2017-10-19)
HIV1-TAT interactive protein (TIP60) is a haploinsufficient tumor suppressor. However, the potential mechanisms endowing its tumor suppressor ability remain incompletely understood. It plays a vital role in virus-induced cancers where TIP60 down-regulates the expression of human papillomavirus (HPV) oncoprotein E6
Mathieu Dalvai et al.
PLoS genetics, 9(4), e1003387-e1003387 (2013-05-03)
Histone variants, including histone H2A.Z, are incorporated into specific genomic sites and participate in transcription regulation. The role of H2A.Z at these sites remains poorly characterized. Our study investigates changes in the chromatin environment at the Cyclin D1 gene (CCND1)
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique