Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU138771

Sigma-Aldrich

MISSION® esiRNA

targeting human NLGN2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGCGCCTTTGACTTCACTGTCTCCAACTTTGTGGACAACCTGTATGGCTACCCGGAAGGCAAGGATGTGCTTCGGGAGACCATCAAGTTTATGTACACAGACTGGGCCGACCGGGACAATGGCGAAATGCGCCGCAAAACCCTGCTGGCGCTCTTTACTGACCACCAATGGGTGGCACCAGCTGTGGCCACTGCCAAGCTGCACGCCGACTACCAGTCTCCCGTCTACTTTTACACCTTCTACCACCACTGCCAGGCGGAGGGCCGGCCTGAGTGGGCAGATGCGGCGCACGGGGATGAACTGCCCTATGTCTTTGGCGTGCCCATGGTGGGTGCCACCGACCTCTTCCCCTGTAACTTCTCCAAGAATGACGTCATGCTCAGTGCCGTGGTCATGACCTACTGGACCAACTTCGCCAAGACTGGGGACCCCAACCAGCCGGTGCCGCAGGATACCAAGTTCATCCACACCAAGCCCAATCGCTTCGAGGAGGTGGTGTGGAGCAAATT

Numéro d'accès Ensembl | humain

ENSG00000169992

Numéro d'accès NCBI

NM_020795

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... NLGN2(57555) , NLGN2(57555)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Margherita Pergolizzi et al.
Biochemical and biophysical research communications, 501(1), 165-171 (2018-05-02)
The synaptic protein Neuroligin 2, similarly to its isoform Neuroligin 1, is produced by endothelial cells, but its activity in the vascular context remains unknown. This study aimed at verifying the hypothesis that Neuroligin 2, in parallel with its extraneuronal
Luan Pereira Diniz et al.
Glia, 62(12), 1917-1931 (2014-07-22)
The balance between excitatory and inhibitory synaptic inputs is critical for the control of brain function. Astrocytes play important role in the development and maintenance of neuronal circuitry. Whereas astrocytes-derived molecules involved in excitatory synapses are recognized, molecules and molecular

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique