Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU138141

Sigma-Aldrich

MISSION® esiRNA

targeting human XRCC3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTGCAGAGTGCAAGAGATGCCTCAGTCAAGTCAGCCAAAAACACGCGGGTCATCCCCAAGCCCCAGAGAGTGACAGAGCCCCGATGACACGGACACCTCGGCTGCTGTCACTTCCCTGGTTCGGGCCTCCCACAGGCTTTGAATTGAAGGCGAGTGCCTCAGAATTTGCATCCATTGTTCTGTCTTTCCTGGGAAGTTATTCATCCTGGTGGCCAGCCCACCGACAAAATGGATTTGGATCTACTGGACCTGAATCCCAGAATTATTGCTGCAATTAAGAAAGCCAAACTGAAATCGGTAAAGGAGGTTTTACACTTTTCTGGACCAGACTTGAAGAGACTGACCAACCTCTCCAGCCCCGAGGTCTGGCACTTGCTGAGAACGGCCTCCTTACACTTGCGGGGAAGCAGCATCCTTACAGCACTGCAGCTG

Numéro d'accès Ensembl | humain

ENSG00000126215

Numéro d'accès NCBI

NM_001100118

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... XRCC3(7517) , XRCC3(7517)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ramon Lopez Perez et al.
Radiotherapy and oncology : journal of the European Society for Therapeutic Radiology and Oncology, 133, 77-86 (2019-04-03)
Carbon ion radiotherapy is a promising therapeutic option for glioblastoma patients due to its high physical dose conformity and greater biological effectiveness than photons. However, the biological effects of carbon ion radiation are still incompletely understood. Here, we systematically compared
Wynand P Roos et al.
Cancer letters, 424, 119-126 (2018-03-27)
Glioblastoma is the most frequent and aggressive form of high-grade malignant glioma. Due to the dismal prognosis faced by patients suffering from this disease, there is a need for identifying new targets that might improve therapy. The aim of this
Jo-Fan Chang et al.
Toxicological sciences : an official journal of the Society of Toxicology, 139(2), 396-406 (2014-03-29)
The nucleus is a key organelle in mammary cells, which is responsible for several cellular functions including cell proliferation, gene expression, and cell survival. In addition, the nucleus is the primary targets of doxorubicin treatment. In the current study, low-abundance
Marco Agostini et al.
Cancer biology & therapy, 16(8), 1160-1171 (2015-05-30)
Preoperative chemoradiotherapy is widely used to improve local control of disease, sphincter preservation and to improve survival in patients with locally advanced rectal cancer. Patients enrolled in the present study underwent preoperative chemoradiotherapy, followed by surgical excision. Response to chemoradiotherapy

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique