Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU136571

Sigma-Aldrich

MISSION® esiRNA

targeting human PREX1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAAGATGGGACAGCGGATTACCATAGCAACGGCTATACCGTCACCAACGGCTGGAAGATCCACAACACGGCCAAGAATAAGTGGTTTGTCTGCATGGCCAAGACGGCAGAGGAGAAGCAGAAGTGGCTGGATGCCATCATCCGCGAGCGGGAGCAGCGCGAGAGCCTGAAGCTGGGCATGGAGCGTGATGCCTACGTCATGATTGCGGAGAAGGGGGAGAAGCTGTACCACATGATGATGAACAAGAAGGTGAACCTCATCAAGGACCGCCGGAGAAAGCTGAGCACTGTCCCCAAGTGCTTTCTTGGCAATGAGTTCGTTGCCTGGCTCCTAGAAATTGGTGAAATCAGCAAGACGGAAGAAGGAGTCAACTTGGGCCAAGCCCTGTTGGAGAATGGCATCATCCACCATGTTTCCGACAAGCACCAGTTCAAGA

Numéro d'accès Ensembl | humain

ENSG00000124126

Numéro d'accès NCBI

NM_020820

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PREX1(57580) , PREX1(57580)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jinhua Wang et al.
Cancer letters, 407, 66-75 (2017-08-15)
P-REX1 (PIP3-dependent Rac exchange factor-1) is a guanine nucleotide exchange factor that activates Rac by catalyzing exchange of GDP for GTP bound to Rac. Aberrant up-regulation of P-REX1 expression has a role in metastasis however, copy number (CN) and function
Nimisha R Kumar et al.
Scientific reports, 9(1), 16980-16980 (2019-11-20)
Molecular factors altered in corneas that develop haze post refractive surgery have been described, but pre-existing factors that predispose clinically normal corneas to aberrant fibrosis post surgery and the role of the corneal epithelium remains unknown. We analyzed the global gene
L M Dillon et al.
Oncogene, 34(30), 3968-3976 (2014-10-07)
Phosphatidylinositol 3-kinase (PI3K) promotes cancer cell survival, migration, growth and proliferation by generating phosphatidylinositol 3,4,5-trisphosphate (PIP3) in the inner leaflet of the plasma membrane. PIP3 recruits pleckstrin homology domain-containing proteins to the membrane to activate oncogenic signaling cascades. Anticancer therapeutics

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique