Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU134141

Sigma-Aldrich

MISSION® esiRNA

targeting human NFYA

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGGTCATCTGGACCATCGTACTTGCTGTGGCTACTTCTAAGACAATGTAGAGGGTTATTAAACCTTGAAACTGCCTTTCCTAAGTAGAGAACAAGACTATTCAACAACTTCTTTGCTGAAGCACTGAGGAGATTTGTAATACTCCTAAAGGAAGGGCCAAACTAGAGATTTTCAATCATAGACTTTGTGACAGCATTTGGGGAACTAAAAGATTCATGTGTTTCAGCCTAGTGGGAGAGAGTGGGGGAGAGGAAGAGAGAGAGAGAGCATGTATACCCGTATGTTATCATAGAGCACGATTCTCCAGTGGATGGATACCTGGAATGGATCATTAAGATGAAGAGAGTAATTCACATTTACTCTAGAACCTTTAACAAGCACTGAAAGGAAGAAGCCTGAGATTTGATCCTTGACAATTTCTGGAAAGCACTGGTCAGTCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hongxin Ma et al.
Oncotarget, 6(2), 1049-1063 (2014-12-05)
We previously reported the tumor suppressor function of Zinc-fingers and homeoboxes 2 (ZHX2) in hepatocellular carcinoma (HCC). Other studies indicate the association of increased ZHX2 expression with improved response to high dose chemotherapy in multiple myeloma. Here, we aim to
Zhongcheng Shi et al.
Nucleic acids research, 43(13), 6257-6269 (2015-06-05)
Roles for SOX9 have been extensively studied in development and particular emphasis has been placed on SOX9 roles in cell lineage determination in a number of discrete tissues. Aberrant expression of SOX9 in many cancers, including colorectal cancer, suggests roles
Siyuan Ding et al.
PLoS biology, 12(1), e1001758-e1001758 (2014-01-11)
Type III interferon (IFN-λ) exhibits potent antiviral activity similar to IFN-α/β, but in contrast to the ubiquitous expression of the IFN-α/β receptor, the IFN-λ receptor is restricted to cells of epithelial origin. Despite the importance of IFN-λ in tissue-specific antiviral

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique