Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU132531

Sigma-Aldrich

MISSION® esiRNA

targeting human ATP6V0A4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCCAGGATCCAAGAAGATGCCACTGAGAACATTGAAGGTGATAGCTCCAGCCCTTCTAGCCGTTCTGGCCAGAGGACTTCTGCAGATACCCACGGGGCTCTGGACGACCATGGAGAAGAGTTCAACTTTGGAGACGTCTTTGTCCACCAAGCCATCCACACCATCGAGTACTGCCTGGGCTGCATTTCAAACACAGCCTCCTACCTGCGGCTCTGGGCCCTCAGCCTGGCTCATGCACAACTGTCTGAAGTGCTCTGGACTATGGTGATGAACAGCGGCCTTCAGACGCGAGGCTGGGGAGGAATCGTCGGGGTTTTTATTATTTTTGCCGTATTTGCTGTCCTGACAGTAGCCATCCTTCTGATCATGGAGGGCCTCTCTGCTTTCCTGCACGCCCTGCGACTGCACTGGGTTGAGTTCCAGAACAAGTTCTATGTCGGGGATGGTTACAAGTTTTCTCCATTCTCCTTTAAACACATCCTGGATGGCACAGCCGAGGAGTAGGCTGAGGGCTGCACCTCCCACGGTGGTCACCATGCCAATGAAGGAAGTT

Numéro d'accès Ensembl | humain

ENSG00000105929

Numéro d'accès NCBI

NM_020632

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ATP6V0A4(50617) , ATP6V0A4(50617)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Shulian Chen et al.
World journal of urology, 35(8), 1247-1254 (2016-12-26)
To investigate the effect of simulated physiological stretch on the expression of extracellular matrix (ECM) proteins and the role of integrin α4/αv, focal adhesion kinase (FAK), extracellular regulated protein kinases 1/2 (ERK1/2) in the stretch-induced ECM protein expression of human
ChangDong Lin et al.
Immunity, 50(1), 137-151 (2019-01-17)
Fever is an evolutionarily conserved response that confers survival benefits during infection. However, the underlying mechanism remains obscure. Here, we report that fever promoted T lymphocyte trafficking through heat shock protein 90 (Hsp90)-induced α4 integrin activation and signaling in T cells.
Yu Yan et al.
Aging, 11(9), 2699-2723 (2019-05-12)
Senescence is a leading cause of age-related cataract (ARC). The current study indicated that the senescence-associated protein, p53, total laminin (LM), LMα4, and transforming growth factor-beta1 (TGF-β1) in the cataractous anterior lens capsules (ALCs) increase with the grades of ARC.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique