Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU117241

Sigma-Aldrich

MISSION® esiRNA

targeting human CDC42

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACTGCAGGGCAAGAGGATTATGACAGATTACGACCGCTGAGTTATCCACAAACAGATGTATTTCTAGTCTGTTTTTCAGTGGTCTCTCCATCTTCATTTGAAAACGTGAAAGAAAAGTGGGTGCCTGAGATAACTCACCACTGTCCAAAGACTCCTTTCTTGCTTGTTGGGACTCAAATTGATCTCAGAGATGACCCCTCTACTATTGAGAAACTTGCCAAGAACAAACAGAAGCCTATCACTCCAGAGACTGCTGAAAAGCTGGCCCGTGACCTGAAGGCTGTCAAGTATGTGGAGTGTTCTGCACTTACACA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xiaolei Liu et al.
Development (Cambridge, England), 145(17) (2018-07-26)
Although major progress in our understanding of the genes and mechanisms that regulate lymphatic vasculature development has been made, we still do not know how lumen formation and maintenance occurs. Here, we identify the Ras-interacting protein Rasip1 as a key
Arjun P Athreya et al.
Oncotarget, 8(16), 27199-27215 (2017-04-21)
We demonstrate that model-based unsupervised learning can uniquely discriminate single-cell subpopulations by their gene expression distributions, which in turn allow us to identify specific genes for focused functional studies. This method was applied to MDA-MB-231 breast cancer cells treated with
Shayoni Ray et al.
Molecular biology of the cell, 25(16), 2393-2407 (2014-06-27)
Coordinated actin microfilament and microtubule dynamics is required for salivary gland development, although the mechanisms by which they contribute to branching morphogenesis are not defined. Because LIM kinase (LIMK) regulates both actin and microtubule organization, we investigated the role of
Tilman D Rachner et al.
Breast cancer research : BCR, 16(1), R20-R20 (2014-02-18)
Amino-bisphosphonates and statins inhibit the mevalonate pathway, and may exert anti-tumor effects. The Wnt inhibitor dickkopf-1 (DKK-1) promotes osteolytic bone lesions by inhibiting osteoblast functions and has been implicated as an adverse marker in multiple cancers. We assessed the effects

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique