Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU114911

Sigma-Aldrich

MISSION® esiRNA

targeting human FAM35A

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCTGCTACATTCCAGGCATTGTACTAAGTATGGGGAACCACAGAGAAGACATTCCCTCAGAAACTGCTGCAGTGCTTTCGCTTATCCCTACCTAAAAAACCGTCAATGTGAAATCATTTCCTTGATTATAACTATAATGATAATGGATTAGTTTATATAAACCTATGTTTAGACAAGTTCAAGACAAGCGTGTCTTTCTATAAAAAGTATTGAAAATGAAGGAAATGAGATCATGTTTCAATTTATTAAAGCAGGGAAGAGCGTTCTGTGCTTAGTTCGTGTCTAGGATTTGAGTGCCTTACTGAATGCATTTACCAGCAAACATGTAGCAATCTGTTCTCTCATTGTGATTGTGGAAGAAGCTCATGTAAAATGATAGTCATTAATGAGGAAGTATGGCGTGG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Shengxian Gao et al.
Nature communications, 9(1), 3925-3925 (2018-09-27)
53BP1 with its downstream proteins, RIF1, PTIP and REV7, antagonizes BRCA1-dependent homologous recombination (HR) and promotes non-homologous end joining (NHEJ) in an unclear manner. Here we show that REV7 forms a complex with two proteins, FAM35A and C20ORF196. We demonstrate
Sylvie M Noordermeer et al.
Nature, 560(7716), 117-121 (2018-07-20)
53BP1 is a chromatin-binding protein that regulates the repair of DNA double-strand breaks by suppressing the nucleolytic resection of DNA termini1,2. This function of 53BP1 requires interactions with PTIP3 and RIF14-9, the latter of which recruits REV7 (also known as

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique