Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU114551

Sigma-Aldrich

MISSION® esiRNA

targeting human APOBEC3B

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTGAAAACGAACCCATCCTCTATGGTCGGAGCTACACTTGGCTGTGCTATGAAGTGAAAATAAAGAGGGGCCGCTCAAATCTCCTTTGGGACACAGGGGTCTTTCGAGGCCAGGTGTATTTCAAGCCTCAGTACCACGCAGAAATGTGCTTCCTCTCTTGGTTCTGTGGCAACCAGCTGCCTGCTTACAAGTGTTTCCAGATCACCTGGTTTGTATCCTGGACCCCCTGCCCGGACTGTGTGGCGAAGCTGGCCGAATTCCTGTCTGAGCACCCCAATGTCACCCTGACCATCTCTGCCGCCCGCCTCTACTACTACTGGGAAAGAGATTACCGAAGGGCGCTCTGCAGGCTGAGTCAGGCAGGAGCCCGCGTGACGATCATGGACTATGAAGAATTTGCATACTGCTGGGAAAACTTTGTGTACAATGAAGGTCAGCAATTCATGC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Qiu-Ping Jia et al.
Cancer chemotherapy and pharmacology, 83(4), 625-637 (2019-01-12)
Compelling evidence establishes the etiological role of viral proteins E6 and E7 of high-risk human papillomaviruses (HPV) in cervical carcinogenesis, but their contribution in chemoresistance that leads to advanced metastatic lesions remains poorly defined. Since metastasis-associated protein 1 (MTA1) upregulation
Min Gwak et al.
Tumori, 100(4), 112e-117e (2014-10-10)
APOBEC3B is a deaminase that possesses DNA C-to-T editing activity. A recent report showed that APOBEC3B mRNA was overexpressed in breast cancer and that its expression was responsible for the high C-to-T mutation spectrum in breast cancer, suggesting that APOBEC3B
Yanmeng Chen et al.
Antiviral research, 149, 16-25 (2017-11-14)
Hepatitis B virus is a partially double-stranded DNA virus that replicates by reverse transcription, which occurs within viral core particles in the cytoplasm. The cytidine deaminase APOBEC3B is a cellular restriction factor for HBV. Recently, it was reported that APOBEC3B
Jian Zhang et al.
International journal of clinical and experimental pathology, 8(5), 5089-5096 (2015-07-21)
Gastric cancer was the third cause of death in China. In this study, we found that the APOBEC3 (apolipoprotein B mRNA-editing enzyme, catalytic polypeptide-like 3) expression was higher in gastric cancer tissues than that in normal tissues and confirmed APOBEC3B
Zhe Jin et al.
Oncology reports, 32(5), 1867-1872 (2014-09-02)
Chondrosarcomas rank as the third most common type of bone tumors. In the present study, we demonstrated that expression of the apolipoprotein B mRNA-editing enzyme, catalytic polypeptide-like 3B (APOBEC3B) was higher in cancer tissues when compared to that in normal tissues. In

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique