Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU114181

Sigma-Aldrich

MISSION® esiRNA

targeting human PRDX3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGATTTCACCTTTGTGTGTCCTACAGAAATTGTTGCTTTTAGTGACAAAGCTAACGAATTTCACGACGTGAACTGTGAAGTTGTCGCAGTCTCAGTGGATTCCCACTTTAGCCATCTTGCCTGGATAAATACACCAAGAAAGAATGGTGGTTTGGGCCACATGAACATCGCACTCTTGTCAGACTTAACTAAGCAGATTTCCCGAGACTACGGTGTGCTGTTAGAAGGTTCTGGTCTTGCACTAAGAGGTCTCTTCATAATTGACCCCAATGGAGTCATCAAGCATTTGAGCGTCAACGATCTCCCAGTGGGCCGAAGCGTGGAAGAAACCCTCCGCTTGGTGAAGGCGTTCCAGTATGTAGAAACACATGGAGAAGTCTGCCCAGCGAACTGGACACCGGATTCTCCTA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Min-Yao Jiang et al.
Oncotarget, 8(46), 80295-80302 (2017-11-09)
Benign prostatic hyperplasia (BPH) is one of the most common diseases in the senior men and age plays an important role in the initiation and development of BPH. Mammalian cells primarily use the autophagy-lysosome system to degrade misfolded/aggregated proteins and
Inah Hwang et al.
Free radical biology & medicine, 131, 162-172 (2018-12-12)
Chronic kidney disease (CKD) has become epidemic worldwide. Mitochondrial reactive oxygen species (ROS)-induced oxidative stress is an important mediator of CKD, and Prx3 plays a critical role in maintenance of mitochondrial ROS. The present study examined the role of Prx3
Hua Zhang et al.
Oncotarget, 8(2), 3471-3480 (2016-12-15)
Peroxiredoxin (PRDX) proteins are involved in carcinogenesis. PRDX3, which is predominantly localized in mitochondria and up-regulated in several human cancers, seems to confer increased treatment resistance and aggressive phenotypes. This study examined the expression profile of PRDX3 and its possible
Brian Cunniff et al.
PloS one, 10(5), e0127310-e0127310 (2015-05-27)
Dysregulation of signaling pathways and energy metabolism in cancer cells enhances production of mitochondrial hydrogen peroxide that supports tumorigenesis through multiple mechanisms. To counteract the adverse effects of mitochondrial peroxide many solid tumor types up-regulate the mitochondrial thioredoxin reductase 2--thioredoxin

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique