Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU113961

Sigma-Aldrich

MISSION® esiRNA

targeting human PARK7

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACTGAAGGAGCAGGAAAACCGGAAGGGCCTGATAGCCGCCATCTGTGCAGGTCCTACTGCTCTGTTGGCTCATGAAATAGGTTTTGGAAGTAAAGTTACAACACACCCTCTTGCTAAAGACAAAATGATGAATGGAGGTCATTACACCTACTCTGAGAATCGTGTGGAAAAAGACGGCCTGATTCTTACAAGCCGGGGGCCTGGGACCAGCTTCGAGTTTGCGCTTGCAATTGTTGAAGCCCTGAATGGCAAGGAGGTGGCGGCTCAAGTGAAGGCTCCACTTGTTCTTAAAGACTAGAGCAGCGAACTGCGACGATCACTTAGAGAAACAGGCCGTTAGGAATCCATTCTCACTGTGTTCGCTCTAAACAAAACAGTGGTAGGTTAATGTGTTCAGAAGTCGCTGTCCTT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hua-Zong Zeng et al.
International journal of molecular sciences, 12(6), 3489-3499 (2011-07-13)
The aim of study is to identify cisplatin-resistance associated biomarkers for non-small cell lung cancers (NSCLC). We use two-dimensional electrophoresis (2-DE) combined with MALDI-TOF mass spectrometry to compare the proteome between lung cancer cell line A549 and its cisplatin-resistant subline
Bijun Qiu et al.
Oncotarget, 8(5), 8499-8511 (2016-12-31)
Chronic liver inflammation and injuries play a critical role in development of hepatocellular carcinoma (HCC). Parkinson disease (autosomal recessive, early onset) 7, encoding PARK7 protein (also called DJ-1), plays important roles in many carcinogenesis processes and is essential in modulating
Canan Schumann et al.
Molecular pharmaceutics, 13(6), 2070-2083 (2016-05-14)
We report an efficient therapeutic modality for platinum resistant ovarian cancer based on siRNA-mediated suppression of a multifunctional DJ-1 protein that is responsible for the proliferation, growth, invasion, oxidative stress, and overall survival of various cancers. The developed therapeutic strategy
Prahlad V Raninga et al.
Apoptosis : an international journal on programmed cell death, 21(12), 1422-1437 (2016-10-28)
Multiple myeloma (MM) is an incurable plasma B cell malignancy. Despite recent advancements in anti-MM therapies, development of drug resistance remains a major clinical hurdle. DJ-1, a Parkinson's disease-associated protein, is upregulated in many cancers and its knockdown suppresses tumor
Xiao-Ling Zhang et al.
Toxicology letters, 271, 74-83 (2017-03-02)
Oxidative stress is thought to be involved in the development of Parkinson's disease (PD). We previously reported that 20C, a bibenzyl compound isolated from Gastrodia elata, possesses antioxidative properties, but its in-depth molecular mechanisms against rotenone-induced neurotoxicity remains unknown. Recent

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique