Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU109681

Sigma-Aldrich

MISSION® esiRNA

targeting human DHX9

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGCTGGGCAGAAGGATTTTTGCACGAGAACATGGATCAAATAAGAAATTGGCAGCACAGTCCTGTGCCCTGTCACTTGTCAGACAACTGTACCATCTTGGAGTGGTTGAAGCTTACTCCGGACTTACAAAGAAGAAGGAAGGAGAGACAGTGGAGCCTTACAAAGTAAACCTCTCTCAAGATTTAGAGCATCAGCTGCAAAACATCATTCAAGAGCTAAATCTTGAGATTTTGCCCCCGCCTGAAGATCCTTCTGTGCCAGTTGCACTCAACATTGGCAAATTGGCTCAGTTCGAACCATCTCAGCGACAAAACCAAGTGGGTGTGGTTCCTTGGTCACCTCCACAATCCAACTGGAATCCTTGGACTAGTAGCAACATTGATGAGGGGCCTCTGGCTTTTGCTACTCC

Numéro d'accès Ensembl | humain

ENSG00000135829

Numéro d'accès NCBI

NM_001357

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... DHX9(1660) , DHX9(1660)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Wenmin Fu et al.
Journal of virology, 93(4) (2018-12-14)
Epstein-Barr virus (EBV) SM protein is an RNA-binding protein that has multiple posttranscriptional gene regulatory functions essential for EBV lytic replication. In this study, we identified an interaction between SM and DHX9, a DExH-box helicase family member, by mass spectrometry
Pratirodh Koirala et al.
Nature communications, 8, 14422-14422 (2017-02-09)
Despite the overwhelming number of human long non-coding RNAs (lncRNAs) reported so far, little is known about their physiological functions for the majority of them. The present study uses a CRISPR/Cas9-based synergistic activation mediator (SAM) system to identify potential lncRNAs
Jie Zhang et al.
Molecular medicine reports, 20(2), 1429-1435 (2019-06-08)
Pathological scarring is a result of the hypertrophy of scar tissue during tissue repair following trauma. The aim of the present study was to assess the effect of ubiquitin‑specific protease 4 (USP4) silencing on pathological scarring, and to evaluate the
Grace S Tan et al.
ACS chemical biology, 7(2), 403-410 (2011-10-27)
Argonaute proteins are the core components of the microRNP/RISC. The biogenesis and function of microRNAs and endo- and exo- siRNAs are regulated by Ago2, an Argonaute protein with RNA binding and nuclease activities. Currently, there are no in vitro assays
Tuğçe Aktaş et al.
Nature, 544(7648), 115-119 (2017-03-30)
Transposable elements are viewed as 'selfish genetic elements', yet they contribute to gene regulation and genome evolution in diverse ways. More than half of the human genome consists of transposable elements. Alu elements belong to the short interspersed nuclear element

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique