Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU108231

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC22A4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CATCAGCTGGGAGATGTTCACTGTGTTATTTGTCATCGTGGGCATGGGCCAGATCTCCAACTATGTGGTAGCCTTCATACTAGGAACAGAAATTCTTGGCAAGTCAGTTCGTATTATATTCTCTACATTAGGAGTGTGCACATTTTTTGCAGTTGGCTATATGCTGCTGCCACTGTTTGCTTACTTCATCAGAGACTGGCGGATGCTGCTGCTGGCGCTGACGGTGCCGGGAGTGCTGTGTGTCCCGCTGTGGTGGTTCATTCCTGAATCTCCCCGATGGCTGATATCCCAGAGAAGATTTAGAGAGGCTGAAGATATCATCCAAAAAGCTGCAAAAATGAACAACATAGCTGTACCAGCAGTGATATTTGATTCTGTGGAGGAGCTAAATCCCCTGAAGCAGCAGAAAGCTTTCATTCTGGACCTGTTCAGGACTCGGAATATTGCCATAATGACCATTATGTCTTTGCTGCTATGGATGCTGAC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Saliha Harrach et al.
Scientific reports, 7(1), 1258-1258 (2017-04-30)
Recent therapeutic approaches of rheumatoid arthritis (RA) address the use of small molecules such as tyrosine kinase inhibitors (TKIs). However, the TKIs developed to date have important side effects and/or scarce efficacy in inflammatory diseases such as RA. Since intracellular
Jiaojiao Cong et al.
Journal of ethnopharmacology, 252, 112581-112581 (2020-01-23)
The herbs of Aconitum are the essential Traditional Chinese medicine and have played an indispensable role in many Asian countries for thousands of years to treat critical illnesses, and chronic, stubborn diseases. However, Aconitum may induce severe neurotoxicity and even

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique