Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU107281

Sigma-Aldrich

MISSION® esiRNA

targeting human ESRRA

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCGCTGTCTGACCAGATGTCAGTACTGCAGAGCGTGTGGATGGAGGTGCTGGTGCTGGGTGTGGCCCAGCGCTCACTGCCACTGCAGGATGAGCTGGCCTTCGCTGAGGACTTAGTCCTGGATGAAGAGGGGGCACGGGCAGCTGGCCTGGGGGAACTGGGGGCTGCCCTGCTGCAACTAGTGCGGCGGCTGCAGGCCCTGCGGCTGGAGCGAGAGGAGTATGTTCTACTAAAGGCCTTGGCCCTTGCCAATTCAGACTCTGTGCACATCGAAGATGCCGAGGCTGTGGAGCAGCTGCGAGAAGCTCTGCACGAGGCCCTGCTGGAGTATGAAGCCGGCCGGGCTGGCCCCGGAGGGGGTGCTGAGCGGCGGCGGGCGGGCAGGCTGCTGCTCACGCTACCGCTCCTCCGCCAGACAGCGGGCAAAGTGCTGGCCCATTTCTATGGGGTGAAGCTGGAGGGCAAGGTGCCCATGCACAAGCTGTTCTTGGAGATGCTCGAGG

Numéro d'accès Ensembl | humain

ENSG00000173153

Numéro d'accès NCBI

NM_004451

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ESRRA(2101) , ESRRA(2101)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
QCS

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xiumin Huang et al.
Cell adhesion & migration, 12(6), 538-547 (2018-05-22)
Estrogenic signals have been suggested to be important for the tumorigenesis and progression of endometrial cancer (EC) cells. Our present data showed that estrogen related receptor alpha (ERRα), while not ERRβ or ERRγ, was significantly elevated in EC cells and
Peng Chen et al.
Journal of cellular biochemistry, 118(1), 74-81 (2016-05-28)
Curcumin has demonstrated valuable therapeutic potential against a variety of human cancers including osteosarcoma. However, the molecular mechanisms underlying its anti-tumor effect remain to be poorly understood. By RNA sequence profiling, we found that curcumin significantly down-regulates the expression of
Kaori Yoriki et al.
Scientific reports, 9(1), 6697-6697 (2019-05-02)
Estrogen-related receptor alpha (ERRα), which shares structural similarities with estrogen receptors, is associated with tumor progression in endometrial cancer, but little is known about the detailed underlying mechanism. We investigated whether ERRα, in cooperation with peroxisome proliferator-activated receptor gamma coactivator
Ankana Tiwari et al.
Scientific reports, 5, 17621-17621 (2015-12-08)
The ESRRA gene encodes a transcription factor and regulates several genes, such as WNT11 and OPN, involved in tumorigenesis. It is upregulated in several cancers, including OSCC. We have previously shown that the tumor suppressor miR-125a targets ESRRA, and its

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique