Accéder au contenu
MilliporeSigma
Toutes les photos(2)

Principaux documents

EHU106441

Sigma-Aldrich

MISSION® esiRNA

targeting human PTEN

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACCGCCAAATTTAATTGCAGAGTTGCACAATATCCTTTTGAAGACCATAACCCACCACAGCTAGAACTTATCAAACCCTTTTGTGAAGATCTTGACCAATGGCTAAGTGAAGATGACAATCATGTTGCAGCAATTCACTGTAAAGCTGGAAAGGGACGAACTGGTGTAATGATATGTGCATATTTATTACATCGGGGCAAATTTTTAAAGGCACAAGAGGCCCTAGATTTCTATGGGGAAGTAAGGACCAGAGACAAAAAGGGAGTAACTATTCCCAGTCAGAGGCGCTATGTGTATTATTATAGCTACCTGTTAAAGAATCATCTGGATTATAGACCAGTGGCACTGTTGTTTCACAAGATGATGTTTGAAACTATTCCAATGTTCAGTGGCGGAACTTGCAATCCTCAGTTTGTGGTCTGCCAGCTAAAGGTGAAGATATATTCCTCCAATTCAGGACCCACACGACGGGAAGACAAGTTCATGTACTTTGAGTTCCCTCAGCCGTTACCT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Lei Dou et al.
Frontiers in oncology, 11, 614035-614035 (2021-03-27)
microRNAs (miRNAs) are of great significance in cancer treatment, which may have a desirable result on the regulation of tumorigenesis, progression, recurrence, and chemo-resistance of ovarian cancer. However, the research on the further potential application of miR-4461 in ovarian cancer
Ke Wang et al.
Biochemical and biophysical research communications, 521(3), 652-659 (2019-11-05)
WW domain containing E3 Ub-protein ligase 2 (WWP2) plays an important role in tumor progression as an E3 ligase of PTEN. Here, we investigated the role of WWP2 in gastric cancer (GC). We found that WWP2 is overexpressed in GC
Bo Yuan et al.
OncoTargets and therapy, 13, 9147-9157 (2020-09-29)
Long non-coding RNA (lncRNA) cancer susceptibility candidate 9 (CASC9) has been reported to play a vital role in tumorigenesis. This study explored the biological role of CASC9 and its regulation mechanism in bladder cancer (BC). Gene expression was evaluated using
Zheng Jin et al.
OncoTargets and therapy, 13, 1073-1086 (2020-02-27)
Glioma is the most commonly diagnosed primary brain tumor. Dysregulation of long non-coding RNA (lncRNA) is associated with initiation and development of various cancer types including glioma. The relative expression of lncRNA was analyzed by real time-quantitative polymerase chain reaction
Guang-Tao Yu et al.
Oncotarget, 6(39), 42067-42080 (2015-11-18)
Myeloid-derived suppressor cells (MDSCs) and tumor associated macrophages (TAMs) play key roles in the tumor immune suppressive network and tumor progression. However, precise roles of programmed death-1 (PD-1) in immunological functions of MDSCs and TAMs in head and neck squamous

Protocoles

Coronavirus qPCR Primer and probe sets for the detection of SARS-CoV-2 (Corona Virus), with additional real-time RT-PCR, RT-qPCR and supporting reagents available.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique