Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU106031

Sigma-Aldrich

MISSION® esiRNA

targeting human CDC20

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTACAGCCAAAAGGCCACTCCTGGCTCCAGCCGGAAGACCTGCCGTTACATTCCTTCCCTGCCAGACCGTATCCTGGATGCGCCTGAAATCCGAAATGACTATTACCTGAACCTTGTGGATTGGAGTTCTGGGAATGTACTGGCCGTGGCACTGGACAACAGTGTGTACCTGTGGAGTGCAAGCTCTGGTGACATCCTGCAGCTTTTGCAAATGGAGCAGCCTGGGGAATATATATCCTCTGTGGCCTGGATCAAAGAGGGCAACTACTTGGCTGTGGGCACCAGCAGTGCTGAGGTGCAGCTATGGGATGTGCAGCAGCAGAAACGGCTTCGAAATATGACCAGTCACTCTGCCCGAGTGGGCTCCCTAAGCTGGAACAGCTATATCCTGTCCAGTGGTTCACGTTCTGGCCACATCCACCACCATGATGT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yuan Gao et al.
Aging, 13(2), 2668-2680 (2021-01-08)
The molecular mechanism of osteosarcoma (OS) pathogenesis is poorly understood. The Notch signaling pathway has been shown to be critically involved in tumorigenesis, including OS. Therefore, we explored the molecular mechanism by which the Notch-1 signaling pathway is involved in
Shujie Cheng et al.
International journal of oncology, 54(6), 2250-2256 (2019-05-14)
Aberrant expression of cell division cycle 20 (CDC20) is associated with malignant progression and poor prognosis in various types of cancer. The development of specific CDC20 inhibitors may be a novel strategy for the treatment of cancer with elevated expression of
Jia Li et al.
International journal of oncology, 45(4), 1547-1555 (2014-07-30)
Cell division cycle 20 (CDC20) encodes a regulatory protein interacting with the anaphase-promoting complex/cyclosome (APC/C) in the cell cycle and plays important roles in tumorigenesis and progression of multiple tumors. The present study aimed to investigate the clinical significance of
N Bah et al.
Cell death & disease, 5, e1291-e1291 (2014-06-13)
Antimitotic agents such as microtubule inhibitors (paclitaxel) are widely used in cancer therapy while new agents blocking mitosis onset are currently in development. All these agents impose a prolonged mitotic arrest in cancer cells that relies on sustained activation of
Karine Boulay et al.
Nucleic acids research, 42(12), 7867-7883 (2014-06-08)
Staufen1 (Stau1) is a ribonucleic acid (RNA)-binding protein involved in the post-transcriptional regulation of gene expression. Recent studies indicate that Stau1-bound messenger RNAs (mRNAs) mainly code for proteins involved in transcription and cell cycle control. Consistently, we report here that

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique