Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU100711

Sigma-Aldrich

MISSION® esiRNA

targeting human TGM2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGAGCATGAACATGGGCAGTGACTTTGACGTCTTTGCCCACATCACCAACAACACCGCTGAGGAGTACGTCTGCCGCCTCCTGCTCTGTGCCCGCACCGTCAGCTACAATGGGATCTTGGGGCCCGAGTGTGGCACCAAGTACCTGCTCAACCTCAACCTGGAGCCTTTCTCTGAGAAGAGCGTTCCTCTTTGCATCCTCTATGAGAAATACCGTGACTGCCTTACGG

Numéro d'accès Ensembl | humain

ENSG00000198959

Numéro d'accès NCBI

NM_004613

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... TGM2(7052) , TGM2(7052)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Robin Delaine-Smith et al.
Cancers, 11(5) (2019-05-24)
Colorectal cancer is the third most common cancer worldwide, and the fourth leading cause of malignancy-related mortality. This highlights the need to understand the processes driving this disease in order to develop new treatments and improve patient outcomes. A potential
Yesim Bagatur et al.
Cell adhesion & migration, 12(2), 138-151 (2017-05-13)
Tissue transglutaminase (TG2) is the ubiquitously expressed member of transglutaminase family and shown to play a critical role in the development and progression of drug resistance malignancies. We have previously showed the association of TG2 upregulation with progression and metastasis
Ramon L Serrano et al.
PloS one, 14(4), e0212235-e0212235 (2019-04-04)
Neointimal hyperplasia, stimulated by injury and certain vascular diseases, promotes artery obstruction and tissue ischemia. In vascular smooth muscle cell (VSMCs), multiple modulators of protein handling machinery regulate intimal hyperplasia. These include elements of the VSMC unfolded protein response to
Deborah T Leicht et al.
Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer, 9(6), 872-881 (2014-05-16)
Esophageal adenocarcinomas (EAC) are aggressive cancers that are increasing in incidence and associated with a poor prognosis. The identification of highly expressed genes in EAC relative to metaplastic Barrett's esophagus (BE) may provide new targets for novel early cancer detection
Ahmed A Ashour et al.
Journal of cellular and molecular medicine, 18(11), 2235-2251 (2014-09-13)
Pancreatic ductal adenocarcinoma is one of the lethal cancers with extensive local tumour invasion, metastasis, early systemic dissemination and poorest prognosis. Thus, understanding the mechanisms regulating invasion/metastasis and epithelial-mesenchymal transition (EMT), is the key for developing effective therapeutic strategies for
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique