Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU095611

Sigma-Aldrich

MISSION® esiRNA

targeting human SNCA (1)

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTGAAGCAACACTGCCAGAAGTGTGTTTTGGTATGCACTGGTTCCTTAAGTGGCTGTGATTAATTATTGAAAGTGGGGTGTTGAAGACCCCAACTACTATTGTAGAGTGGTCTATTTCTCCCTTCAATCCTGTCAATGTTTGCTTTACGTATTTTGGGGAACTGTTGTTTGATGTGTATGTGTTTATAATTGTTATACATTTTTAATTGAGCCTTTTATTAACATATATTGTTATTTTTGTCTCGAAATAATTTTTTAGTTAAAATCTATTTTGTCTGATATTGGTGTGAATGCTGTACCTTTC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hyeong-Jin Baek et al.
Neuroscience letters, 600, 6-11 (2015-06-03)
Notch signaling pathway is well known that it is involved in regulating cell fate, proliferation and homeostasis. In this study, we show a novel function of alpha-synuclein (SNCA) to promote degradation of Notch1 intracellular domain (Notch1-IC) through Fbw7, ubiquitin E3
Yong-Xiao Li et al.
Cancer science, 109(4), 1263-1275 (2018-01-26)
Medulloblastoma (MB) is the most common malignant brain tumor in childhood. It contains at least four distinct molecular subgroups. The aim of this study is to explore novel diagnostic and potential therapeutic markers within each subgroup of MB, in particular

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique