Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU094691

Sigma-Aldrich

MISSION® esiRNA

targeting human CD44

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTAAAGGGATTCCCATCATTGGAATCTTATCACCAGATAGGCAAGTTTATGACCAAACAAGAGAGTACTGGCTTTATCCTCTAACCTCATATTTTCTCCCACTTGGCAAGTCCTTTGTGGCATTTATTCATCAGTCAGGGTGTCCGATTGGTCCTAGAACTTCCAAAGGCTGCTTGTCATAGAAGCCATTGCATCTATAAAGCAACGGCTCCTGTTAAATGGTATCTCCTTTCTGAGGCTCCTACTAAAAGTCATTTGTTACCTAAACTTATGTGCTTAACAGGCAATGCTTCTCAGACCACAAAGCAGAAAGAAGAAGAAAAGCTCCTGACTAAATCAGGGCTGGGCTT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Zenghui Fang et al.
Experimental cell research, 382(1), 111462-111462 (2019-06-14)
Scaffolding adaptor Gab2 is overexpressed in a subset of high-grade ovarian cancer. Our published work shows that Gab2 via PI3K enhances migratory behaviors and epithelial to mesenchymal transition (EMT) features of ovarian cancer cells in vitro. However, it is still
Doohyung Lee et al.
Hepatology (Baltimore, Md.), 61(6), 1978-1997 (2015-01-30)
Tumor metastasis involves circulating and tumor-initiating capacities of metastatic cancer cells. Epithelial-mesenchymal transition (EMT) is related to self-renewal capacity and circulating tumor cell (CTC) characteristics for tumor metastasis. Although tumor metastasis is a life-threatening, complicated process that occurs through circulation
Anna-Karin Ekman et al.
The Journal of investigative dermatology, 139(7), 1564-1573 (2019-01-27)
Psoriasis is an inflammatory skin disorder characterized by the hyperproliferation of basal epidermal cells. It is regarded as T-cell mediated, but the role of keratinocytes (KCs) in the disease pathogenesis has reemerged, with genetic studies identifying KC-associated genes. We applied
Gan Yu et al.
The Journal of urology, 192(4), 1229-1237 (2014-05-29)
We investigated the potential functions of miR-34a in CD44 transcriptional complexes in renal cell carcinoma. We detected miR-34a expression by quantitative real-time polymerase chain reaction. Oligonucleotides were used to over express miR-34a. Cell proliferation and xenograft assays, colony formation and
Jingying Zheng et al.
Theranostics, 7(5), 1373-1388 (2017-04-25)
CD44 and EpCAM play crucial roles in intraperitoneal ovarian cancer development. In this study, we developed an RNA-based bispecific CD44-EpCAM aptamer that is capable of blocking CD44 and EpCAM simultaneously by fusing single CD44 and EpCAM aptamers with a double

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique