Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU093561

Sigma-Aldrich

MISSION® esiRNA

targeting human MYCN (1)

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GACGTGGTCACTGTGGAGAAGCGGCGTTCCTCCTCCAACACCAAGGCTGTCACCACATTCACCATCACTGTGCGTCCCAAGAACGCAGCCCTGGGTCCCGGGAGCAGTCCAGCGAGCTGATCCTCAAACGATGCCTTCCCATCCACCAGCAGCACAACTATGCCGCCCCCTCTCCCTACGTGGAGAGTGAGGATGCACCCCCACAGAAGAAGATAAAGAGCGAGGCGTCCCCACGTCCGCTCAAGAGTGTCATCCCCCCAAAGGCTAAGAGCTTGAGCCCCCGAAACTCTGACTCGGAGGACAGTGAGCGTCGCAGAAACCACAACATCCTGGAGCGCCAGCGCCGCAACGACCTTCGGTCCAGCTTTCTCAC

Numéro d'accès Ensembl | humain

ENSG00000134323

Numéro d'accès NCBI

NM_005378

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... MYCN(4613) , MYCN(4613)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yosuke Watanabe et al.
Medical oncology (Northwood, London, England), 34(9), 158-158 (2017-08-10)
Although DNA hypermethylation at non-promoter region of the Zygote arrest 1 (ZAR1) gene has been observed in many types of tumor, including neuroblastoma (NB), the role of this gene in tumor development and/or progression is unclear. One reason is that
Huogang Wang et al.
Oncotarget, 8(49), 86312-86324 (2017-11-22)
Small cell lung cancer (SCLC) is a clinically aggressive cancer with very poor prognosis. Amplification of
Luca Montemurro et al.
Cancer research, 79(24), 6166-6177 (2019-10-17)
Approximately half of high-risk neuroblastoma is characterized by MYCN amplification. N-Myc promotes tumor progression by inducing cell growth and inhibiting differentiation. MYCN has also been shown to play an active role in mitochondrial metabolism, but this relationship is not well
T Tao et al.
Oncogene, 36(27), 3852-3867 (2017-03-07)
The nucleolar factor, digestive organ expansion factor (DEF), has a key role in ribosome biogenesis, functioning in pre-ribosomal RNA (pre-rRNA) processing as a component of the small ribosomal subunit (SSU) processome. Here we show that the peripheral sympathetic nervous system
Xiaoqin Jiang et al.
Molecular medicine reports, 18(5), 4595-4602 (2018-09-18)
Hypoxic‑ischemic encephalopathy is one of the most notable causes of brain injury in newborns. Cerebral ischemia and reperfusion lead to neuronal damage and neurological disability. In vitro and in vivo analyses have indicated that E3 ubiquitin protein ligase (Huwe1) is important for

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique