Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU093291

Sigma-Aldrich

MISSION® esiRNA

targeting human IRAK1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATCCTCCAGAAAGTCGAGCAGCACCCACCTCCAACCTCGGGCCAGTGTCTTCAGGCTTTACTGGGGACCTGCGAGCTGGCCTAATGTGGTGGCCTGCAAGCCAGGCCATCCCTGGGCGCCACAGACGAGCTCCGAGCCAGGTCAGGCTTCGGAGGCCACAAGCTCAGCCTCAGGCCCAGGCACTGATTGTGGCAGAGGGGCCACTACCCAAGGTCTAGCTAGGCCCAAGACCTAGTTACCCAGACAGTGAGAAGCCCCTGGAAGGCAGAAAAGTTGGGAGCATGGCAGACAGGGAAGGGAAACATTTTCAGGGAAAAGACATGTATCACATGTCTTCAGAAGCAAGTCAGGTTTCATGTAACCGAGTGTCCTCTTGCGTGTCCAAAAGTAGCCCAGGGCTGTAGCACAGGCTTCACAGTGATT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xian Shuang Liu et al.
Molecular neurobiology, 54(1), 227-237 (2016-01-08)
Stroke induces new myelinating oligodendrocytes that are involved in ischemic brain repair. Molecular mechanisms that regulate oligodendrogenesis have not been fully investigated. MicroRNAs (miRNAs) are small non-coding RNA molecules that post-transcriptionally regulate gene expression. MiR-146a has been reported to regulate
Yan Gao et al.
Molecular medicine reports, 14(6), 5685-5692 (2016-11-24)
The present study aimed to reduce the expression of interleukin-1 receptor-associated kinase 1 (IRAK-1) in dendritic cells (DCs) by RNA interference (RNAi). Subsequently, its effects on the expression of costimulatory surface molecules, the release of inflammatory cytokines, and the proliferation of
Wei Chen et al.
OncoTargets and therapy, 13, 12787-12796 (2020-12-29)
Interleukin-1 receptor-associated kinase 1 (IRAK1) was shown to contribute to a variety of cancer-related processes. However, the function of IRAK1 in hepatocellular carcinoma (HCC) pathogenesis has not been investigated in detail. IRAK1 expression in HCC was examined by immunohistochemistry, qRT-PCR
Hong-Yi Zhang et al.
Journal of pediatric surgery, 55(11), 2308-2316 (2020-04-24)
To investigate the effects of low dose endotoxin on transcriptional activity in intestinal epithelium, and its role in necrotizing enterocolitis (NEC). Lipopolysaccharides (LPS) were injected into the amniotic cavity of pregnant mice under ultrasound guidance. The effects of LPS on
Florian Meisgen et al.
The Journal of investigative dermatology, 134(7), 1931-1940 (2014-03-29)
Keratinocytes represent the first line of defense against pathogens in the skin and have important roles in initiating and regulating inflammation during infection and autoimmunity. Here we investigated the role of miR-146a in the regulation of the innate immune response

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique