Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU087591

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC22A17

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AAGGATTGGCGATTCCTACAGCGAATGATCACCGCTCCCTGCATCCTCTTCCTGTTTTATGGCTGGCCTGGTTTGTTCCTGGAGTCCGCACGGTGGCTGATAGTGAAGCGGCAGATTGAGGAGGCTCAGTCTGTGCTGAGGATCCTGGCTGAGCGAAACCGGCCCCATGGGCAGATGCTGGGGGAGGAGGCCCAGGAGGCCCTGCAGGACCTGGAGAATACCTGCCCTCTCCCTGCAACATCCTCCTTTTCCTTTGCTTCCCTCCTCAACTACCGCAACATCTGGAAAAATCTGCTTATCCTGGGCTTCACCAACTTCATTGCCCATGCCATTCGCCACTGCTACCAGCCTGTGGGAGGAGGAGGGAGCCCATCGGACTTCTACCTGTGCTCTCTGCTGG

Numéro d'accès Ensembl | humain

ENSG00000092096

Numéro d'accès NCBI

NM_020372

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SLC22A17(51310) , SLC22A17(51310)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Sobeyda B Gomez-Chou et al.
Cancer research, 77(10), 2647-2660 (2017-03-03)
Lipocalin-2 (LCN2) promotes malignant development in many cancer types. LCN2 is upregulated in patients with pancreatic ductal adenocarcinoma (PDAC) and in obese individuals, but whether it contributes to PDAC development is unclear. In this study, we investigated the effects of
Bilge Ören et al.
The Journal of pathology, 239(3), 274-285 (2016-04-03)
Tumour cell-secreted factors skew infiltrating immune cells towards a tumour-supporting phenotype, expressing pro-tumourigenic mediators. However, the influence of lipocalin-2 (Lcn2) on the metastatic cascade in the tumour micro-environment is still not clearly defined. Here, we explored the role of stroma-derived

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique