Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU083661

Sigma-Aldrich

MISSION® esiRNA

targeting human WT1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCAGGGCATGTGTATGTGTCTGCTAATGTAAACTTTGTCATGGTTTCCATTTACTAACAGCAACAGCAAGAAATAAATCAGAGAGCAAGGCATCGGGGGTGAATCTTGTCTAACATTCCCGAGGTCAGCCAGGCTGCTAACCTGGAAAGCAGGATGTAGTTCTGCCAGGCAACTTTTAAAGCTCATGCATTTCAAGCAGCTGAAGAAAAAATCAGAACTAACCAGTACCTCTGTATAGAAATCTAAAAGAATTTTACCATTCAGTTAATTCAATGTGAACACTGGCACACTGCTCTTAAGAAACTATGAAGATCTGAGATTTTTTTGTGTATGTTTTTGACTCTTTTGAGTGGTAATCATATGTGTCTTTATAGATGTACATACCTCCTTGCACAAATGGAG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xue Wang et al.
Theriogenology, 148, 8-17 (2020-03-04)
To determine the role of 3, 3', 5-triiodo-L thyroxine (T3) in the differentiation of Sertoli cells (SCs) and the factors influencing maturity via the Wilms' tumor 1 (WT1)/non-canonical Wnt signaling pathway, high purity SCs were isolated from newborn calves' testes
Junjie Chen et al.
Journal of experimental & clinical cancer research : CR, 35(1), 173-173 (2016-11-09)
The metastatic cascade is a complex and multistep process with many potential barriers. Recently, miR-193a has been reported to be a suppressive miRNA in multiple types of cancers, but its underlying anti-oncogenic activity in non-small cell lung cancers (NSCLC) is
Tove Ullmark et al.
Biochemical and biophysical research communications, 482(4), 802-807 (2016-11-28)
Wilms' tumor gene 1 (WT1) is a zinc finger transcription factor that has been implicated as an oncogene in leukemia and several other malignancies. When investigating possible gene expression network partners of WT1 in a large acute myeloid leukemia (AML)
Abheepsa Mishra et al.
American journal of physiology. Renal physiology, 314(5), F832-F843 (2018-01-24)
The loss of podocyte (PD) molecular phenotype is an important feature of diabetic podocytopathy. We hypothesized that high glucose (HG) induces dedifferentiation in differentiated podocytes (DPDs) through alterations in the apolipoprotein (APO) L1-microRNA (miR) 193a axis. HG-induced DPD dedifferentiation manifested
Kai Meng et al.
Molecular reproduction and development, 86(11), 1731-1740 (2019-09-07)
Bovine theca cells are thought to differentiate from cortical stromal cells, and ovary-derived Wilms' tumor 1+ (WT1+ ) cells are the primary source of mouse theca cells. However, it is not known whether the differentiation of cortical stromal cells is

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique