Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU083211

Sigma-Aldrich

MISSION® esiRNA

targeting human TLE1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCCTCGTCAGTGCTTAGCTGTGACATCTCTGTGGATGATAAGTACATAGTCACTGGCTCGGGGGACAAGAAGGCTACAGTCTATGAAGTCATCTACTGAAAACATTATGTGGTTTAACGTTTATAGTTGAATTGGGCCAAAATGTTTCGAATTTATAGAAATAGAAAAGTTGTAACTTTAAAAGAGAAAAAAAATTACAAACACCTGTTTCCAAACCTTGACAGAAAACTACTTTGAGTCTACAAAGAGGAGGCGACAAGTCCATCAGCAGAAAGTCACCTGTCTACATAGACCAAATGGAGCACCAAGGCCAAGCGGACAGAGGGGCCATGGGTTGTAGGATTGAGGAACGGAATCTGCCGACTCACATGACAGCCCATTCTTTCTTTCTGGGTGATCTGGG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Wei Chen et al.
Bioscience, biotechnology, and biochemistry, 84(6), 1176-1182 (2020-03-03)
Liver damage induced by ischemia/reperfusion (I/R) remains a primary issue in multiple hepatic surgeries. Innate immune-mediated inflammatory responses during the reperfusion stage aggravate the injury. Nevertheless, the detailed mechanism of hepatic I/R has not been fully clarified yet. Our research
Federica De Paoli et al.
FEBS letters, 590(1), 43-52 (2016-01-15)
Macrophages display heterogeneous phenotypes, including the classical M1 proinflammatory and the alternative M2 anti-inflammatory polarization states. The transducin-like enhancer of split-1 (TLE1) is a transcriptional corepressor whose functions in macrophages have not been studied yet. We report that TLE1 is
Xin Yao et al.
Oncotarget, 8(42), 72235-72249 (2017-10-27)
The Transducin-like enhancer of split 1 (TLE1) corepressor protein is overexpressed in human lung tumors and is a putative lung-specific oncogene. However, the molecular mechanism underlying its oncogenic function remains to be delineated. Here, we report an important role of
Xin Yao et al.
PloS one, 9(7), e101564-e101564 (2014-07-09)
The mitochondrial Bit1 (Bcl-2 inhibitor of transcription 1) protein is a part of an apoptotic pathway that is uniquely regulated by integrin-mediated attachment. As an anoikis effector, Bit1 is released into the cytoplasm following loss of cell attachment and induces

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique