Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU080371

Sigma-Aldrich

MISSION® esiRNA

targeting human STEAP4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGCGCCTCTCCCTCAGTTATGGAGAAAACTTGTATAGATGCACTTCCTCTTACTATGAATTCTTCAGAAAAGCAAGAGACTGTATGTATTTTTGGAACTGGTGATTTTGGAAGATCACTGGGATTGAAAATGCTCCAGTGTGGTTATTCTGTTGTTTTTGGAAGTCGAAACCCCCAGAAGACCACCCTACTGCCCAGTGGTGCAGAAGTCTTGAGCTATTCAGAAGCAGCCAAGAAGTCTGGCATCATAATCATAGCAATCCACAGAGAGCATTATGATTTTCTCACAGAATTAACTGAGGTTCTCAATGGAAAAATATTGGTAGACATCAGCAACAACCTCAAAATCAATCAATATCCAGAATCTAATGCAGAGTACCTTGCTCATTTGGTGCCAGGAGCCCACGTGGTAAAAGCATTTAACACCATCTCAGCCTGGG

Numéro d'accès Ensembl | humain

ENSG00000127954

Numéro d'accès NCBI

NM_024636

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... STEAP4(79689) , STEAP4(79689)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Feng Wang et al.
Journal of cellular and molecular medicine, 21(12), 3298-3308 (2017-06-21)
The aim of this study was to investigate whether overexpression of STAMP2 improves insulin resistance by regulating angiogenesis in adipose tissues. The characteristics of diabetic mice were measured by serial metabolite and pathology tests. Samples were obtained from epididymal, subcutaneous
Yoo Jin Oh et al.
Molecular pharmacology, 94(6), 1401-1411 (2018-10-28)
Nonalcoholic fatty liver disease (NAFLD) is an increasingly studied condition that can progress to end-stage liver disease. Although NAFLD was first described in 1980, a complete understanding of the mechanism and causes of this disease is still lacking. Six-transmembrane protein
Hye Young Kim et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(9), 12354-12366 (2020-07-29)
Although previous studies have shown that the administration of fibroblast growth factor 21 (FGF21) reverses hepatic steatosis, the mechanism by which FGF21 exerts a therapeutic effect on nonalcoholic fatty liver disease (NAFLD) is not yet entirely understood. We previously demonstrated
Sung Won Lee et al.
Bone research, 6, 20-20 (2018-07-14)
Free fatty acids (FFAs), which are elevated with metabolic syndrome, are considered the principal offender exerting lipotoxicity. Few previous studies have reported a causal relationship between FFAs and osteoarthritis pathogenesis. However, the molecular mechanism by which FFAs exert lipotoxicity and

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique