Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU076751

Sigma-Aldrich

MISSION® esiRNA

targeting human BRD4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAACCCTAACAAGCCCAAGAGGCAGACCAACCAACTGCAATACCTGCTCAGAGTGGTGCTCAAGACACTATGGAAACACCAGTTTGCATGGCCTTTCCAGCAGCCTGTGGATGCCGTCAAGCTGAACCTCCCTGATTACTATAAGATCATTAAAACGCCTATGGATATGGGAACAATAAAGAAGCGCTTGGAAAACAACTATTACTGGAATGCTCAGGAATGTATCCAGGACTTCAACACTATGTTTACAAATTGTTACATCTACAACAAGCCTGGAGATGACATAGTCTTAATGGCAGAAGCTCTGGAAAAGCTCTTCTTGCAAAAAATAAATGAGCTACCCACAGAAGAAACCGAGATCATGATAGTCCAGGCAAAAGGAAGAGGACGTGGGAGGAAAGAAACA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Zeynab Najafova et al.
Nucleic acids research, 45(1), 127-141 (2016-09-22)
Proper temporal epigenetic regulation of gene expression is essential for cell fate determination and tissue development. The Bromodomain-containing Protein-4 (BRD4) was previously shown to control the transcription of defined subsets of genes in various cell systems. In this study we
Stella Liong et al.
Reproduction (Cambridge, England), 155(6), 573-582 (2018-05-12)
Preeclampsia affects 5% of all pregnancies and is a serious disorder of pregnancy, characterised by high maternal blood pressure, placental hypoxia, fluid retention (oedema) and proteinuria. Women with preeclampsia are associated with exaggerated levels of pro-inflammatory cytokines, chemokines and anti-angiogenic
Hong Zuo et al.
Biochimie, 165, 100-107 (2019-07-22)
High glucose (HG)-induced podocyte injury contributes to the pathogenesis of diabetic nephropathy, a severe complication of diabetes. Bromodomain-containing protein 4 (BRD4) has emerged as a critical regulator for cell injury. However, whether BRD4 participates in HG-induced podocyte injury remains unclear.
Kun Tang et al.
American journal of physiology. Lung cellular and molecular physiology, 316(4), L621-L629 (2019-01-18)
Chronic obstructive pulmonary disease (COPD) is a common chronic airway inflammatory disease. MicroRNAs are shown to be involved in the regulation of inflammation. We investigated the role of microRNA-29b (miR-29b) in the airway inflammation in COPD. The expression of miR-29b
Sushmita Mustafi et al.
EBioMedicine, 43, 201-210 (2019-04-13)
Bromodomain and extra-terminal inhibitors (BETi) have shown efficacy for the treatment of aggressive triple negative breast cancer (TNBC). However, BETi are plagued by a narrow therapeutic window as manifested by severe toxicities at effective doses. Therefore, it is a limitation

Global Trade Item Number

RéférenceGTIN
EHU076751-20UG4061831353488
EHU076751-50UG4061831373097

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique