Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU073901

Sigma-Aldrich

MISSION® esiRNA

targeting human AXIN1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACTTCTGGTTTGCCTGCACTGGCTTCAGGAAGCTGGAGCCCTGTGACTCGAACGAGGAGAAGAGGCTGAAGCTGGCGAGAGCCATCTACCGAAAGTACATTCTTGATAACAATGGCATCGTGTCCCGGCAGACCAAGCCAGCCACCAAGAGCTTCATAAAGGGCTGCATCATGAAGCAGCTGATCGATCCTGCCATGTTTGACCAGGCCCAGACCGAAATCCAGGCCACTATGGAGGAAAACACCTATCCCTCCTTCCTTAAGTCTGATATTTATTTGGAATATACGAGGACAGGCTCGGAGAGCCCCAAAGTCTGTAGTGACCAGAGCTCTGGGTCAGGGACAGGGAAGGGCATATCTGGATACCTGCCGACCTTAAATGAAGATGAGGAATGGAAGTGTGACCAGG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yu Chen et al.
PloS one, 10(7), e0133115-e0133115 (2015-07-24)
During development, scaffold proteins serve as important platforms for orchestrating signaling complexes to transduce extracellular stimuli into intracellular responses that regulate dendritic spine morphology and function. Axin ("axis inhibitor") is a key scaffold protein in canonical Wnt signaling that interacts
Yongjuan Zhang et al.
Biochemical and biophysical research communications, 513(1), 261-268 (2019-04-08)
Caveolin-1 has been reported to play an important role in the pathogenesis of acute respiratory distress syndrome (ARDS). This study was designed to identify Caveolin-1-interacting proteins to reveal the molecular mechanisms of ARDS. Yeast two-hybrid screening was performed using Caveolin-1
Shiwei Zhou et al.
Pharmaceutics, 13(3) (2021-04-04)
Genetic evidence has indicated that β-catenin plays a vital role in glucose and lipid metabolism. Here, we investigated whether pyrvinium, an anthelmintic agent previously reported as a down-regulator of cellular β-catenin levels, conferred any metabolic advantages in treatment of metabolic
Dongshao Chen et al.
Cancer management and research, 11, 1349-1362 (2019-02-28)
Characterized by elevated AFP levels in serum, AFP-producing gastric cancer (APGC) is a very special type of gastric cancer (GC) that is difficult to treat and has poor prognosis. However, little is known about the role of AFP in GC
Hae-Kyung Lee et al.
Oncogene, 37(31), 4273-4286 (2018-05-02)
The adenomatous polyposis coli (APC) protein has a tumor-suppressor function by acting as a negative regulator of the Wnt signaling pathway. While its role as a tumor suppressor is well-defined, the post-translational modifications that regulate APC stability are not fully

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique