Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU071861

Sigma-Aldrich

MISSION® esiRNA

targeting human APLN

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGTTTTCAGGAGCTCTGGTGAAGTGGGTGGAGCATCAGCGTTTGCTCAGTTAAGGGAGAGGTAGAGAGGGGCCCGTGAAGTCCTTTGTCACTTCTCTTGCCTTAGTGTGCCTCCCAATACTCCCTTCTTCCTGCCCCCACACCCCATCCCCAGCTAGCCCAAGCTCCAGGTCAGGAGGGGAGGGTGCTGGGCCTGACATGGCTATATACCCTCCCAGGAGTAAAAGCCAAGCAAGAGGTTGTTTTTGCCAAGAATCACAGAATGTTAGAGCTGACAGGACCCTTGAAGGTCACTTAGCCTTCTTAGGCAAACGCCTGCAAAACAGAAGCCTGGAGAGGGGAGTGACCTGCTCAGAGTCATTGCAGAGCCGGGATGGGGACCAGGTCTCCCATCTCCTACTTTATGACGCC

Numéro d'accès Ensembl | humain

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yoko Yokoyama et al.
Arthritis & rheumatology (Hoboken, N.J.), 70(10), 1661-1672 (2018-04-21)
Apelin/APJ signaling has been determined to regulate cardiac and arterial fibrosis and to be involved in the pathogenesis of pulmonary arterial hypertension. Our objective was to elucidate the role of apelin in skin fibrosis in systemic sclerosis (SSc). Expression of
Aung Than et al.
The Journal of biological chemistry, 290(23), 14679-14691 (2015-05-02)
Brown adipose tissue expends energy in the form of heat via the mitochondrial uncoupling protein UCP1. Recent studies showed that brown adipose tissue is present in adult humans and may be exploited for its anti-obesity and anti-diabetes actions. Apelin is

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique