Accéder au contenu
MilliporeSigma
Toutes les photos(2)

Key Documents

EHU070511

Sigma-Aldrich

MISSION® esiRNA

targeting human CDK4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(2)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAAACTCTGAAGCCGACCAGTTGGGCAAAATCTTTGACCTGATTGGGCTGCCTCCAGAGGATGACTGGCCTCGAGATGTATCCCTGCCCCGTGGAGCCTTTCCCCCCAGAGGGCCCCGCCCAGTGCAGTCGGTGGTACCTGAGATGGAGGAGTCGGGAGCACAGCTGCTGCTGGAAATGCTGACTTTTAACCCACACAAGCGAATCTCTGCCTTTCGAGCTCTGCAGCACTCTTATCTACATAAGGATGAAGGTAATCCGGAGTGAGCAATGGAGTGGCTGCCATGGAAGGAAGAAAAGCTGCCATTTCCCTTCTGGACACTGAGAGGGCAATCTTTGCCTTTATCTCTGAGGCTATGGAGGGTCCTCCTCCATCTTTCTACAGAGATTACTTTGCTGCCTTAATGACATTCCCCTCCCACCTCTCCTTTTGAGGCTTCTCCTTCTCCTTCCCA

Numéro d'accès Ensembl | humain

ENSG00000135446

Numéro d'accès NCBI

NM_000075

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CDK4(1019) , CDK4(1019)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Liam Cornell et al.
Cell reports, 26(10), 2667-2680 (2019-03-07)
CDK4/6 inhibition is now part of the standard armamentarium for patients with estrogen receptor-positive (ER+) breast cancer, so that defining mechanisms of resistance is a pressing issue. Here, we identify increased CDK6 expression as a key determinant of acquired resistance
Smruthi Vijayaraghavan et al.
Nature communications, 8, 15916-15916 (2017-06-28)
Deregulation of the cell cycle machinery is a hallmark of cancer. While CDK4/6 inhibitors are FDA approved (palbociclib) for treating advanced estrogen receptor-positive breast cancer, two major clinical challenges remain: (i) adverse events leading to therapy discontinuation and (ii) lack
Amriti R Lulla et al.
Cancer research, 77(24), 6902-6913 (2017-10-25)
CDK4/6 targeting is a promising therapeutic strategy under development for various tumor types. In this study, we used computational methods and The Cancer Genome Atlas dataset analysis to identify novel miRNAs that target CDK4/6 and exhibit potential for therapeutic development
Nikhlesh K Singh et al.
The Journal of biological chemistry, 292(34), 14080-14091 (2017-06-29)
Although the involvement of Rho proteins in the pathogenesis of vascular diseases is well studied, little is known about the role of their upstream regulators, the Rho guanine nucleotide exchange factors (RhoGEFs). Here, we sought to identify the RhoGEFs involved
Guoyan Liu et al.
The Journal of pathology, 233(3), 308-318 (2014-03-08)
Ovarian carcinoma is the most lethal gynaecological malignancy. Better understanding of the molecular pathogenesis of this disease and effective targeted therapies are needed to improve patient outcomes. MicroRNAs play important roles in cancer progression and have the potential for use
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique