Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU070211

Sigma-Aldrich

MISSION® esiRNA

targeting human TRPC1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTTGGAAAATTTCTTGGGATGTTTCTTCTTGTTTTGTTTTCTTTCACAATTGGACTGACACAACTGTATGATAAAGGATATACTTCAAAGGAGCAGAAGGACTGTGTAGGCATCTTCTGTGAACAGCAAAGCAATGATACCTTCCATTCGTTCATTGGCACCTGCTTTGCTTTGTTCTGGTATATTTTCTCCTTAGCGCATGTGGCAATCTTTGTCACAAGATTTAGCTATGGAGAAGAACTGCAGTCCTTTGTGGGAGCTGTCATTGTTGGTACATACAATGTCGTGGTTGTGATTGTGCTTACCAAACTGCTGGTGGCAATGCTTCATAAAAGCTTTCAGTTGATAGCAAATCATGAAGACAAAGAATGGAAGTTTGCTCGAGCAAAATTATGGCTTAGCTACTTTGATGACAAATGTACGTTACCTCCACCTTTCAACATCATTCCCTCACCA

Numéro d'accès Ensembl | humain

ENSG00000144935

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... TRPC1(7220) , TRPC1(7220)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Qinqin Pu et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(1), 1074-1085 (2018-08-02)
Airway remodeling with progressive epithelial alterations in the respiratory tract is a severe consequence of asthma. Although dysfunctional signaling transduction is attributed to airway inflammation, the exact mechanism of airway remodeling remains largely unknown. TRPC1, a member of the transient
Corena V Grant et al.
Breast cancer research and treatment, 177(2), 345-355 (2019-06-24)
Triple-negative breast cancers (TNBCs) represent a heterogeneous group of tumors. The lack of targeted therapies combined with the inherently aggressive nature of TNBCs results in a higher relapse rate and poorer overall survival. We evaluated the heterogeneity of TNBC cell
Xiaoyu Zhang et al.
Journal of cellular biochemistry, 119(7), 6033-6044 (2018-03-27)
This study aimed to validate whether transient receptor potential channel1 (TRPC1) and TRPC3 participate in the regulation the proliferation of airway smooth muscle cells (ASMCs) through modulating calcium ion (Ca2+ ) influx in vitro. Chronic model of murine asthma was
Michael F Emmons et al.
Scientific reports, 7(1), 2685-2685 (2017-06-05)
The emergence of drug resistance continues to be a major hurdle towards improving patient outcomes for the treatment of Multiple Myeloma. MTI-101 is a first-in-class peptidomimetic that binds a CD44/ITGA4 containing complex and triggers necrotic cell death in multiple myeloma
Yuyang Sun et al.
Journal of cellular physiology, 230(11), 2848-2856 (2015-04-23)
Calcium-activated chloride channel (CaCC) plays an important role in modulating epithelial secretion. It has been suggested that in salivary tissues, sustained fluid secretion is dependent on Ca(2+) influx that activates ion channels such as CaCC to initiate Cl(-) efflux. However

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique