Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU067151

Sigma-Aldrich

MISSION® esiRNA

targeting human MMP13

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGGTCCAGGAGATGAAGACCCCAACCCTAAACATCCAAAAACGCCAGACAAATGTGACCCTTCCTTATCCCTTGATGCCATTACCAGTCTCCGAGGAGAAACAATGATCTTTAAAGACAGATTCTTCTGGCGCCTGCATCCTCAGCAGGTTGATGCGGAGCTGTTTTTAACGAAATCATTTTGGCCAGAACTTCCCAACCGTATTGATGCTGCATATGAGCACCCTTCTCATGACCTCATCTTCATCTTCAGAGGTAGAAAATTTTGGGCTCTTAATGGTTATGACATTCTGGAAGGTTATCCCAAAAAAATATCTGAACTGGGTCTTCCAAAAGAAGTTAAGAAGATAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTCCTGTTCTCAGGAAACCAGGTCTGGAG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Désolés, nous n'avons pas de COA pour ce produit disponible en ligne pour le moment.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Nobuaki Ozeki et al.
International journal of molecular sciences, 17(2), 221-221 (2016-02-11)
We established a differentiation method for homogeneous α7 integrin-positive human skeletal muscle stem cell (α7⁺hSMSC)-derived osteoblast-like (α7⁺hSMSC-OB) cells, and found that interleukin (IL)-1β induces matrix metalloproteinase (MMP)-13-regulated proliferation of these cells. These data suggest that MMP-13 plays a potentially unique
Rui Min Li et al.
American journal of cancer research, 8(6), 964-980 (2018-07-24)
The highly refractory nature of cervical cancer to chemotherapeutic drugs and its epithelial-to-mesenchymal transition (EMT) are the key reasons contributing to the poor prognosis of this disease. Golgi Membrane Protein 1 (GOLM1), a protein involved in the trafficking of proteins
Xiao-Dong Li et al.
Chinese medical journal, 130(6), 717-721 (2017-03-18)
Dendritic cells are professional antigen-presenting cells found in an immature state in epithelia and interstitial space, where they capture antigens such as pathogens or damaged tissue. Matrix metallopeptidase 13 (MMP-13), a member of the collagenase subfamily, is involved in many
Chia-Li M Shih et al.
Molecular biology reports, 42(7), 1225-1232 (2015-02-16)
Adipose tissue remodeling by the matrix metalloproteases (MMPs) is critical for tissue hypertrophy and obesity. MMP-13 is an important protein that is highly expressed in adipose tissue but whose potential role in adipose tissue expansion is poorly characterized. We investigated

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique