Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU065551

Sigma-Aldrich

MISSION® esiRNA

targeting human ATP11C

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAGAAAGAGCGAGAGACCTTGAAGGTTTTAAAAATGTTCACCGACTTCCTATCATTTATGGTTCTATTCAACTTTATCATTCCTGTCTCCATGTACGTCACAGTAGAAATGCAGAAATTCTTGGGCTCCTTCTTCATCTCATGGGATAAGGACTTTTATGATGAAGAAATTAATGAAGGAGCCCTGGTTAACACATCAGACCTTAATGAAGAACTTGGTCAGGTGGATTATGTATTTACAGATAAGACTGGAACACTCACTGAAAACAGCATGGAATTCATTGAATGCTGCATAGATGGCCACAAATATAAAGGTGTAACTCAAGAGGTTGATGGATTATCTCAAACTGATGGAACTTTAACATATTTTGACAAAGTAGATAAGAATCGAGAAGAGCTGTTTCTACGTGCCTTGTGTTTATGTCATACTGTAGAAATCAAAACAAACGATGCTGTTGATGGAGCTA

Numéro d'accès Ensembl | humain

ENSG00000101974

Numéro d'accès NCBI

NM_001010986

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ATP11C(286410) , ATP11C(286410)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Alessandra Ghiani et al.
PloS one, 11(5), e0155803-e0155803 (2016-05-18)
Tomato (Solanum lycopersicum) is one of the most extensively consumed vegetables but, unfortunately, it is also able to induce allergic reactions. In the past, it has been shown that the choice of tomato cultivar significantly influenced the allergic reaction of
Theo Rispens et al.
PloS one, 8(2), e55566-e55566 (2013-02-08)
IgE antibodies to gal-α-1,3-gal-β-1,4-GlcNAc (α-gal) can mediate a novel form of delayed anaphylaxis to red meat. Although IgG antibodies to α-gal (anti-α-gal or anti-Gal) are widely expressed in humans, IgE anti-α-gal is not. We explored the relationship between the IgG
Donatien Kamdem Toukam et al.
PloS one, 7(5), e38068-e38068 (2012-06-06)
Although human immunodeficiency type 1 (HIV-1) infection induces strong antibody responses to the viral envelope glycoprotein (Env) only a few of these antibodies possess the capacity to neutralize a broad range of strains. The induction of such antibodies represents an
Yan-Da Lai et al.
International journal of molecular sciences, 17(2), 214-214 (2016-02-11)
Vascular endothelial growth factor (VEGF) is an important stimulator for angiogenesis in solid tumors. Blocking VEGF activity is an effective therapeutic strategy to inhibit tumor growth and metastasis. Avastin, a humanized monoclonal antibody recognizes VEGF, has been approved by the
Simone Mader et al.
Journal of neuroinflammation, 8, 184-184 (2011-12-30)
Serum autoantibodies against the water channel aquaporin-4 (AQP4) are important diagnostic biomarkers and pathogenic factors for neuromyelitis optica (NMO). However, AQP4-IgG are absent in 5-40% of all NMO patients and the target of the autoimmune response in these patients is
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique