Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU064011

Sigma-Aldrich

MISSION® esiRNA

targeting human PSAT1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTGTAAAGCTGGTGGGACCTAATGTCACCTTAATTCTGACTTGAACTGGAAGCATTTTAAGAAATCTTGTTGCTTTTCTAACAAATTCCCGCGTATTTTGCCTTTGCTGCTACTTTTTCTAGTTAGATTTCAAACTTGCCTGTGGACTTAATAATGCAAGTTGCGATTAATTATTTCTGGAGTCATGGGAACACACAGCACAGAGGGTAGGGGGGCCCTCTAGGTGCTGAATCTACACATCTGTGGGGTCTCCTGGGTTCAGCGGCTGTTGATTCAAGGTCAACATTGACCATTGGAGGAGTGGTTTAAGAGTGCCAGGCGAAGGGCAAACTGTAGATCGATCTTTATGCTGTTATTACAGGAGAAGTGACATACTTTATATATGTTTATATTAGCAAGGTCTGTTTTTAATACCA

Numéro d'accès Ensembl | humain

ENSG00000135069

Numéro d'accès NCBI

NM_021154

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PSAT1(29968) , PSAT1(29968)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yiqun Zhang et al.
OncoTargets and therapy, 13, 5443-5453 (2020-07-02)
A growing number of studies have found that the serine-glycine biosynthesis pathway is highly activated for biosynthesis in cancer progression and metastasis. Phosphoserine aminotransferase 1 (PSAT1) catalyzes the second step of the serine-glycine biosynthesis pathway; the effects and mechanism of
Nadia Vié et al.
Molecular cancer, 7, 14-14 (2008-01-29)
Colorectal cancer (CRC) is one of the most common causes of cancer death throughout the world. In this work our aim was to study the role of the phosphoserine aminotransferase PSAT1 in colorectal cancer development. We first observed that PSAT1
Stephanie Metcalf et al.
Clinical & experimental metastasis, 37(1), 187-197 (2019-10-21)
Breast cancer is the second leading cause of cancer-related deaths among women and 90% of these mortalities can be attributed to progression to metastatic disease. In particular, triple negative breast cancer (TNBC) is extremely aggressive and frequently metastasizes to multiple
J Patrick Murphy et al.
Cell reports, 24(9), 2381-2391 (2018-08-30)
NAD+ is a key metabolic redox cofactor that is regenerated from nicotinamide through the NAD+ salvage pathway. Here, we find that inhibiting the NAD+ salvage pathway depletes serine biosynthesis from glucose by impeding the NAD+-dependent protein, 3-phosphoglycerate dehydrogenase (PHGDH). Importantly, we

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique