Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU063441

Sigma-Aldrich

MISSION® esiRNA

targeting human PACSIN2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAGGAAGACGCAGAACAACAGAAATAGCCGCCCCTCCCCGCCCACTGTGCCTGTTGGCCTATCATAGATCTCTATGTTCTTGACTTTGTCTCTCCTTTCCGAGTCAATGGTGGGTTACACTGATCTTGTTCCACTGATTACTCTCTCTGACGAGTCCATCACCTGCAACTTAAATGAACAAGCTTACATCCCATTTTGAGTGAAGATTTTGAGGTTTTTAATTTAAAGGCTGTGTACAGTTATACTTTTTTATACACCTGTTCATTTCTACTTAAATTATGGCACAGATTGATGCGCACCAGTCTTGAGGAAACGATCTCCCTATTCCCTTACCCTGTTACTCAGCCACGCCGTGTGTAGGCTTAGCCTCAGGTGGCAGATGTTTGAGGAAAGGAATTATGCCAGGAAGGTGGGACCGGGTTATGGTCGGGTTTCTATTGGGAATGCTCTTTGTGCTTTTGGGCATCTGAAT

Numéro d'accès Ensembl | humain

ENSG00000100266

Numéro d'accès NCBI

NM_007229

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PACSIN2(11252) , PACSIN2(11252)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xiaohe Tian et al.
Science advances, 6(48) (2020-11-29)
The blood-brain barrier is made of polarized brain endothelial cells (BECs) phenotypically conditioned by the central nervous system (CNS). Although transport across BECs is of paramount importance for nutrient uptake as well as ridding the brain of waste products, the
Meagan M Postema et al.
Molecular biology of the cell, 30(19), 2515-2526 (2019-08-08)
Apical microvilli are critical for the homeostasis of transporting epithelia, yet mechanisms that control the assembly and morphology of these protrusions remain poorly understood. Previous studies in intestinal epithelial cell lines suggested a role for the F-BAR domain protein PACSIN2

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique